Rfam ID: RF00167 (Purine riboswitch)
RF03165 (2dG-II purine riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
Carrying an aptamer domain similar in sequence and secondary structure to the guanine riboswitch, the 2'-dG riboswitch exhibits improved affinities for 2'-deoxyguanosine (2'-dG), 3'-deoxyguanosine (3'-dG) and guanosine, and contains a uracil ribonucleotide in a conserved position of the ligand-binding aptamer domain. Up to now, three classes of 2'-dG riboswitches, named 2'-dG-I, 2'-dG-II and 2'-dG-III, have been identified, wherein the first two classes of 2'-dG riboswitches have atomic-resolution structural models[2-6].Gene association
The gene associateds with 2'-dG-I, 2'-dG-II and 2'-dG-III RNAs are different from each other. 2'-dG-I RNAs in Mesoplasma florum are associated with genes annotated as ribonucleotide reductase. Genes located downstream from 2'-dG-II RNAs in Gracillimonas tropica are predicted to encode a signal receiver domain, endonuclease I, phospholipase D, and ComEC. ComEC is a competence protein involved in importing foreign DNA and endonuclease I could mitigate a lack of 2'-dG by salvaging deoxyribonuc. 2'-dG-III RNAs from Bacillus sp. are associated with genes encoding for purine nucleoside hydrolase, which uses nucleosides as substrates and produces free nucleobases as products[2,4,6].
|
|
Gene regulation
Putative mechanisms for regulation of gene expression by 2'-dG-I in in Mesoplasma florum, 2'-dG-II in Gracillimonas tropica and 2'-dG-III in Bacillus sp. are shown below. We present the prototypical mechanism, but not all possible mechanisms[2,4,6].
|
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for riboswitches that recognize purines, which are dominated by guanine riboswitches. Bottom: Secondary structure depictions of the 2'-dG-II riboswitch in an environmental sequence sample according to PDB ID: 6P2H[1,4,6].
5'GGGUGUAAUCUCCAAAAUAUGGUUGGGGAGCCUCCACCAGUGAACCGUAAAAUCGCUGUCACCACCCAG3' (Sequence from bottom structure )
The overall structure of the 2'-dG-I riboswitch in Mesoplasma florum was generated from PDB ID: 3SKI at 2.30 Å resolution bound with 2'-dG. 2'-dG (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the 2'-dG-I riboswitch in Mesoplasma florum generated from PDB ID: 3SKI at 2.30 Å. 2'-dG (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the 2'-dG-I riboswitch bound with 2'-dG[3].
Left: Surface representation of the binding pocket of the 2'-dG-II riboswitch in an environmental sequence sample generated from PDB ID: 6P2H 2.80 Å. 2'-dG (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the 2'-dG-II riboswitch bound with 2'-dG[5].
Ligand recognition
Chemical structures of 2'-deoxyguanosine (2'-dG) and its analogs. The apparent KD of each compound of three classes of 2'-dG riboswitches is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2,4,6].
|
|
References
[1] Interactions between deoxyribonucleotide and DNA synthesis.
Reichard, P.
Annu. Rev. Biochem. 57, (1988).
[2] Guanine riboswitch variants from Mesoplasma florum selectively recognize 2'-deoxyguanosine.
Kim, J. N., Roth, A. & Breaker, R. R.
Proc. Natl. Acad. Sci. U. S. A. 104, (2007).
[3] Structural principles of nucleoside selectivity in a 2'-deoxyguanosine riboswitch.
Pikovskaya, O., Polonskaia, A., Patel, D. J. & Serganov, A.
Nat. Chem. Biol. 7, (2011).
[4] Bioinformatic analysis of riboswitch structures uncovers variant classes with altered ligand specificity.
Weinberg, Z., Nelson, J. W., Lünse, C. E., Sherlock, M. E. & Breaker, R. R.
Proc. Natl. Acad. Sci. U. S. A. 114, (2017).
[5] Structural basis for 2'-deoxyguanosine recognition by the 2'-dG-II class of riboswitches.
Matyjasik, M. M. & Batey, R. T.
Nucleic Acids Res. 47, (2019).
[6] Variants of the guanine riboswitch class exhibit altered ligand specificities for xanthine, guanine, or 2'-deoxyguanosine.
Hamal, D. S., Panchapakesan, S. S. S., Slattery, P., Roth, A. & Breaker, R. R.
Proc. Natl. Acad. Sci. U. S. A. 119, (2022).