Rfam ID: RF01482 (AdoCbl riboswitch)

    RF00174 (Cobalamin riboswitch)

    RF01689 (AdoCbl variant RNA)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2000[1] Discovery of the 5'-leader sequences of the btuB mRNAs recognizing cobalamine to control gene expresion

    Validation of the AdoCbl riboswitch 2002[2]

    2003[3] The consensus secondary structure model

    The revision of the consensus secondary structure model and validation of the AqCbl riboswitch 2004[5]

    2010[6] Discovery of the AdoCbl riboswitch variants

    Crystal structure of the AdoCbl and AqCbl riboswitch 2012[7]

    2012[8] Crystal structure of AdoCbl riboswitch bound with AdoCbl

    Mg2+ induced conformational changes of the AdoCbl riboswitch from E. coli2014[9]

    2017[11] New classification of the cobalamine riboswitch

    Crystal structure of the atypical cobalamin riboswitch comprising the complete aptamer domain and a part of the expression platform 2020[12]

    2021[13] The conformational ensemble of the AdoCbl riboswitch for ligand recognition

    The plasticity and selectivity of the cobalamine riboswitch to sense cobalamin derivatives 2023[14]

2023...



Description

Cobalamin riboswitch is a cis-regulatory element which is widely distributed in 5untranslated regions of vitamin B12 (Cobalamin) related genes in bacteria. Cobalamin (vitamin B12, coenzyme B12 ) riboswitches are structured RNA elements that regulate adjacent genes related to cobalamin metabolism in response to cobalamin binding. Riboswitches are RNA-based genetic regulatory elements present in the 5' untranslated region (5' UTR) of primarily bacterial RNA. These switches bind to a ligand, which is generally a metabolite, with high affinity and specificity. Ligand binding mediates allosteric rearrangement of mRNA structure, and this results in modulation of gene expression or translation of mRNA to yield a protein. The cobalamin riboswitch, along with most other riboswitches, are cis-regulatory. This means they regulate genes involved in the same metabolic pathways as the metabolite they bind, which creates regulation through a negative feedback loop. Riboswitches are grouped into classes by the ligand that they bind because the ligand-binding or aptamer domain is highly conserved across species. Riboswitches, including the cobalamin riboswitch, have garnered a lot of attention recently due to their therapeutic and synthetic potential, as well as their interesting structural properties. As of 2019, cobalamin riboswitches have been identified in over 5000 species of bacteria. Cobalamin riboswitches are broadly classified by the identity of the aptamer, but can be further classified into AdoCbl riboswitch and AqCbl riboswitch based on cobalamin analogue selectivity and peripheral structural elements (From Wikipedia).


Gene association

Biosynthetic pathways for adenosylcobalamin in bacteria. The anaerobic and aerobic Ado-CBL pathways are characterized by the early and late cobalt insertions, respectively[4].

drawing


Gene regulation

Proposal mechanism of the AdoCbl riboswitch to regulate gene expression. Top: transcriptional attenuation (Symbiobacterium thermophilum), Bottom: translation initiation inhibition (proteobacteria and actinobacteria). RNA is depicted with black lines; P2 and peripheral extensions in P6 are omitted. Complementary regions are in blue. KL denotes a kissing-loop (KL) interaction between L5 of the receptor and L13 of the regulatory domain that instructs the expression machinery. RBS denotes ribosome binding site. We present the prototypical mechanism, but not all possible mechanisms[3,8].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the AdoCbl riboswitch. Bottom: Secondary structure depictions of the Symbiobacterium thermophilum AdoCbl riboswitch according to PDB ID: 4GMA. AdoCbl is denoted in red. KL denotes a kissing-loop (KL) interaction between L5 of the receptor and L13 of the regulatory domain that instructs the expression machinery[4,8].

5'GGCGGCAGGUGCUCCCGACCCUGCGGUCGGGAGUUAAAAGGGAAGCCGGUGCAAGUCCGGCACGGUCCCGCCACUGUGACGGGGAGUCGCCCCUCGGGAUGUGCCACUGGCCCGAAGGCCGGGAAGGCGGAGGGGCGGCGAGGAUCCGGAGUCAGGAAACCUGCCUGCCGUC3' (Sequence from bottom structure )



Top: Consensus sequence and secondary structure model for the AqCbll riboswitch. Bottom: Secondary structure depictions of the AqCbl riboswitch from environmental metagenomes of the ocean surface according to PDB ID: 4FRN. AqCbl is denoted in red. KL denotes a kissing-loop (KL) interaction between L5 of the receptor and L13 of the regulatory domain that instructs the expression machinery[5,7].

5'GGGCUAAAAGCAUGGUGGGAAAGUGACGUGUAAUUCGUCCACAUUACUUGAUACGGUUAUACUCCGAAUGCCACCUAGCCCAAAGUAGAGCAAGGAGACUCA3' (Sequence from bottom structure )



3D visualisation

The overall structure of the Symbiobacterium thermophilum AdoCbl riboswitch was generated from PDB ID: 4GXY at 3.05 Å resolution bound with AdoCbl. AdoCbl (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [8].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






The overall structure of the env8AqCbl riboswitch from environmental metagenomes of the ocean surface was generated from PDB ID: 4FRN at 3.43 Å resolution bound with AqCbl. AqCbl (shown in sticks) is colored in red. KL denotes a kissing-loop (KL) interaction between L5 of the receptor and L13 of the regulatory domain that instructs the expression machinery. Additional available structures that have been solved and detailed information are accessible on Structures page [7].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Symbiobacterium thermophilum AdoCbl riboswitch generated from PDB ID: 4GXY at 3.05 Å resolution. AdoCbl (shown in sticks) is colored in red. Right: Details of riboswitch-AdoCbl interactions. Putative intermolecular hydrogen bonds are shown as dashed lines. [8].

drawing drawing


Left: Surface representation of the binding pocket of the AqCbl riboswitch from environmental metagenomes of the ocean surface generated from PDB ID: 4FRN at 3.43 Å resolution. AqCbl (shown in sticks) is colored in red. Right: Recognition of AqCbl by the AqCbl riboswitch[7].

drawing drawing


Ligand recognition

Chemical structures of cobalamin and its analogs. The apparent KD of each compound is shown on bottom. Cobalamins contain a corrin ring with a cobalt atom coordinated by an α-axial dimethylbenzimidazole (DMB) and by a variable β-axial group (R: adenosylcobalamin (AdoCbl, i), methylcobalamin (MeCbl, ii), aquocobalamin (AqCbl, iii), or cyanocobalamin (CNCbl, iv)). Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3,5,7].

drawing



References

[1] Adenosylcobalamin inhibits ribosome binding to btuB RNA.
Nou, X. & Kadner, R. J.
Proc. Natl. Acad. Sci. U. S. A. 97, (2000).

[2] Genetic control by a metabolite binding mRNA.
Nahvi, A. et al.
Chem. Biol. 9, (2002).

[3] Regulation of the vitamin B12 metabolism and transport in bacteria by a conserved RNA structural element.
Vitreschak, A. G., Rodionov, D. A., Mironov, A. A. & Gelfand, M. S.
RNA 9, (2003).

[4] Comparative genomics of the vitamin B12 metabolism and regulation in prokaryotes.
Rodionov, D. A., Vitreschak, A. G., Mironov, A. A. & Gelfand, M. S.
J. Biol. Chem. 278, (2003).

[5] Coenzyme B12 riboswitches are widespread genetic control elements in prokaryotes.
Nahvi, A., Barrick, J. E. & Breaker, R. R.
Nucleic Acids Res. 32, (2004).

[6] Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes.
Weinberg, Z. et al.
Genome Biol. 11, (2010).

[7] B12 cofactors directly stabilize an mRNA regulatory switch.
Johnson, J. E., Reyes, F. E., Polaski, J. T. & Batey, R. T.
Nature 492, (2012).

[8] Structural insights into ligand binding and gene expression control by an adenosylcobalamin riboswitch.
Peselis, A. & Serganov, A.
Nat. Struct. Mol. Biol. 19, (2012).

[9] Mg2+-induced conformational changes in the btuB riboswitch from E. coli.
Choudhary, P. K. & Sigel, R. K.
RNA 20, (2014).

[10] Tb(3+)-Cleavage Assays Reveal Specific Mg(2+) Binding Sites Necessary to Pre-fold the btuB Riboswitch for AdoCbl Binding.
Choudhary, P. K., Gallo, S. & Sigel, R. K.
Frontiers in chemistry 5, (2017).

[11] Cobalamin riboswitches exhibit a broad range of ability to discriminate between methylcobalamin and adenosylcobalamin.
Polaski, J. T., Webster, S. M., Johnson, J. E. & Batey, R. T.
J. Biol. Chem. 292, (2017).

[12] Crystal structure of an atypical cobalamin riboswitch reveals RNA structural adaptability as basis for promiscuous ligand binding.
Chan, C. W. & Mondragón, A.
Nucleic Acids Res. 48, (2020).

[13] Conformational Ensemble of AdoCbl Riboswitch Provides Stable Structural Elements for Conformation Selection and Population Shift in Cobalamin Recognition.
Ma, B., Bai, G., Nussinov, R., Ding, J. & Wang, Y.-X.
J. Phys. Chem. B 125, 2589–2596 (2021).

[14] Targeting Riboswitches with Beta-Axial-Substituted Cobalamins.
Lennon, S. R. et al.
ACS Chem. Biol. 18, 1136–1147 (2023).