Rfam ID: RF00050 (FMN riboswitch (RFN element))


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    1999[1] Discovery of the RFN element involved in bacterial riboflavin synthesis genes regulation

    The model of the RFN element to regulate riboflavin metabolism and transportation 2002[2]

    2002[3] Validation of the RFN element as the FMN riboswitch

    Assessment of the kinetics of FMN binding to the mRNA by smFRET 2005[4]

    2009[5] Crystal structures of FMN riboswitch bound to FMN, riboflavin and roseoflavin

    Roseoflavin a natural antibiotic directly binds to FMN riboswitch and regulates gene expression 2009[6]

    2011[7] Crystal structure of FMN riboswitch-Free state

    Discovery of 5FDQD bound to FMN riboswitch 2015[8]

    2015[9] Discovery of ribocil by phenotypic screen and the crystal structure of which bound to FMN riboswitch

    Discovery of the variants of the FMN riboswitch 2017[11]

    2020[14] Further insight to the structural basis for conformational switching of the FMN riboswitch

    New compounds target the FMN riboswitch for antimycobacterial therapy 2021[15]

    2022[16] Design and applications of antisense oligonucleotides as antibacterial agents that target the FMN riboswitch

2023...



Description

The FMN riboswitch (also known as RFN element) is a highly conserved RNA element which is naturally occurring, and is found frequently in the 5'-untranslated regions of prokaryotic mRNAs that encode for flavin mononucleotide (FMN) biosynthesis and transport proteins. This element is a metabolite-dependent riboswitch that directly binds FMN in the absence of proteins, thus giving it the ability to regulate RNA expression by responding to changes in the concentration of FMN. In Bacillus subtilis, previous studies have shown that this bacterium utilizes at least two FMN riboswitches, where one controls translation initiation, and the other controls premature transcription termination. Regarding the second riboswitch in Bacilius subtilis, premature transcription termination occurs within the 5' untranslated region of the ribDEAHT operon, precluding access to the ribosome-binding site of ypaA mRNA. FMN riboswitches also have various magnesium and potassium ions dispersed throughout the nucleotide structure, some of which participate in binding of FMN (From Wikipedia).


Gene association

The riboflavin biosynthesis pathway in Escherichia coli. The genes under contol of the FMN ribswtch are colored in red[2].

drawing


Gene regulation

Model for the Bacillus subtilis FMN riboswitch to regulate gene expression. Shaded regions identify the putative anti-terminator structure that is disrupted after binding of FMN and formation of the P1 structure. We present the prototypical mechanism, but not all possible mechanisms[2-3].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the FMN riboswitch. Bottom: Secondary structure depictions of the Fusobacterium nucleatum FMN riboswitch according to PDB ID: 3F2Q. The bound FMN is denoted in red[5].

5'GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC3' (Sequence from bottom structure )



3D visualisation

The overall structure of the Fusobacterium nucleatum FMN riboswitch was generated from PDB ID: 3F2Q at 2.95 Å resolution bound with FMN. FMN (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [5].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Fusobacterium nucleatum FMN riboswitch generated from PDB ID: 3F2Q at 2.95 Å resolution. FMN (shown in sticks) is labeled in red. Green spheres depict cations assigned to Mg 2+. Right: Details of riboswitch–FMN interactions mediated by Mg 2+ (green)[5].

drawing drawing


Ligand recognition

Chemical structures of flavin mononucleotide (FMN) and its analogs. The apparent KD of each compound is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3,5,8-9].

drawing



References

[1] A conserved RNA structure element involved in the regulation of bacterial riboflavin synthesis genes.
Gelfand, M. S., Mironov, A. A., Jomantas, J., Kozlov, Y. I. & Perumov, D. A.
Trends Genet. 15, (1999).

[2] Regulation of riboflavin biosynthesis and transport genes in bacteria by transcriptional and translational attenuation.
Vitreschak, A. G., Rodionov, D. A., Mironov, A. A. & Gelfand, M. S.
Nucleic Acids Res. 30, (2002).

[3] An mRNA structure that controls gene expression by binding FMN.
Winkler, W. C., Cohen-Chalamish, S. & Breaker, R. R.
Proc. Natl. Acad. Sci. U. S. A. 99, (2002).

[4] The speed of RNA transcription and metabolite binding kinetics operate an FMN riboswitch.
Wickiser, J. K., Winkler, W. C., Breaker, R. R. & Crothers, D. M.
Mol. Cell 18, (2005).

[5] Coenzyme recognition and gene regulation by a flavin mononucleotide riboswitch.
Serganov, A., Huang, L. & Patel, D. J.
Nature 458, (2009).

[6] Roseoflavin is a natural antibacterial compound that binds to FMN riboswitches and regulates gene expression.
Lee, E. R., Blount, K. F. & Breaker, R. R.
RNA Biol. 6, (2009).

[7] Molecular sensing by the aptamer domain of the FMN riboswitch: a general model for ligand binding by conformational selection.
Vicens, Q., Mondragón, E. & Batey, R. T.
Nucleic Acids Res. 39, (2011).

[8] Novel riboswitch-binding flavin analog that protects mice against Clostridium difficile infection without inhibiting cecal flora.
Blount, K. F. et al.
Antimicrob. Agents Chemother. 59, (2015).

[9] Selective small-molecule inhibition of an RNA structural element.
Howe, J. A. et al.
Nature 526, (2015).

[10] Atomic resolution mechanistic studies of ribocil: A highly selective unnatural ligand mimic of the E. coli FMN riboswitch.
Howe, J. A., L. Xiao, T. O. Fischmann, H. Wang, H. Tang, A. Villafania, R. Zhang, C. M. Barbieri and T. Roemer.
RNA Biol. 13, (2016).

[11] Bioinformatic analysis of riboswitch structures uncovers variant classes with altered ligand specificity.
Weinberg, Z., Nelson, J. W., Lünse, C. E., Sherlock, M. E. & Breaker, R. R.
Proc. Natl. Acad. Sci. U. S. A. 114, (2017).

[12] Discovery of Selective RNA-Binding Small Molecules by Affinity-Selection Mass Spectrometry.
Rizvi, N. F. et al.
ACS Chem. Biol. 13, (2018).

[13] Structure-Activity Relationship of Flavin Analogues That Target the Flavin Mononucleotide Riboswitch.
Vicens, Q. et al.
ACS Chem. Biol. 13, (2018).

[14] FMN riboswitch aptamer symmetry facilitates conformational switching through mutually exclusive coaxial stacking configurations.
Wilt, H. M., Yu, P., Tan, K., Wang, Y. X. & Stagno, J. R.
Journal of structural biology: X 4, (2020).

[15] Synthesis and evaluation of antimycobacterial activity of riboflavin derivatives.
Harale, B. et al.
Bioorg. Med. Chem. Lett. 48, 128236 (2021).

[16] Engineering Antisense Oligonucleotides as Antibacterial Agents That Target FMN Riboswitches and Inhibit the Growth of Staphylococcus aureus, Listeria monocytogenes, and Escherichia coli.
Traykovska, M. & Penchovsky, R.
ACS Synth. Biol. 11, 1845–1855 (2022).