Rfam ID: RF01734 (Fluoride riboswitch (crcB))


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2010[1] Discovery of crcB motif by comparative genomics-based approach

    Identify the crcB motif as a fluoride riboswitch 2012[2]

    2012[3] Ligand-bound structure of the Thermotoga petrophila fluoride riboswitch

    Structural stability, acidity, and halide selectivity of the fluoride riboswitch recognition site 2015[4]

    2016[5] The cotranscriptional folding pathway of the B. cereus crcB fluoride riboswitch

    Unveiling a novel switching mechanism that employs ligand-dependent suppression of an aptamer excited state to coordinate regulatory conformational transitions 2017[6]

    2020[7] Detection of environmental fluoride via a cell-free riboswitch-based biosensor

    Synthetic gene circuits for organofluorine biosynthesis are implemented in the platform bacterium Pseudomonas putida2020[8]

    2021[9] Ligand F- and transcription factor NusA oppose each other's modulation of downstream pausing and termination by RNA polymerase

    The conformational dynamics of the B.cereus crcB fluoride riboswitch at the single-molecule level 2022[10]

    2023[11]CrcB riboswitch combined with light-up RNA Mango-III was used as a RNA-based fluorogenic biosensor for the detection of fluoride

2023...



Description

The fluoride riboswitch (formerly called the crcB RNA motif) is a conserved RNA structure identified by bioinformatics in a wide variety of bacteria and archaea. These RNAs were later shown to function as riboswitches that sense fluoride ions. These "fluoride riboswitches" increase expression of downstream genes when fluoride levels are elevated, and the genes are proposed to help mitigate the toxic effects of very high levels of fluoride. Many genes are presumed to be regulated by these fluoride riboswitches. Two of the most common encode proteins that are proposed to function by removing fluoride from the cell. These proteins are CrcB proteins and a fluoride-specific subtype of chloride channels referred to as EriCF or ClCF. ClCF proteins have been shown to function as fluoride-specific fluoride/proton antiporters. The three-dimensional structure of a fluoride riboswitch has been solved at atomic resolution by X-ray crystallography. Fluoride riboswitches are found in many organisms within the domains bacteria and archaea, indicating that many of these organisms sometimes encounter elevated levels of fluoride. Of particular interest is Streptococcus mutans, a major cause of dental caries. It has been shown that sodium fluoride has inhibited the growth rate of S. mutans using glucose as an energy and carbon source. However, it is also noteworthy that many organisms that do not encounter fluoride in the human mouth carry fluoride riboswitches or resistance genes (From Wikipedia).


Gene association

Genes most commonly associated with fluoride riboswitches in bacteria and archaea as classified by the Conserved Domain Database. Left: 62% of all riboswitch-associated genes fall into twelve common categories as noted with sections proportional to the number of operons encoding the specified protein. These genes are predominantly bacteria. MFS: major facilitator superfamily; USP: universal stress protein. Right: fluoride riboswitch-associated genes from archaea[2].

drawing


Gene regulation

The fluoride riboswitch from B. cereus regulates gene expression at the transcriptional level. Stabilization of the pseudoknot (PK) upon F- binding (F-) prevents the formation of an intrinsic terminator hairpin, leading to the transcription of the downstream gene. We present the prototypical mechanism, but not all possible mechanisms[9].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the fluoride riboswitch. Bottom: Secondary structure depictions of the Thermotoga petrophila fluoride riboswitch according to PDB ID: 4ENC[3].

5'GGGCGAUGAGGCCCGCCCAAACUGCCCUGAAAAGGGCUGAUGGCCUCUACUG3' (Sequence from bottom structure )



3D visualisation

The overall structure of the Thermotoga petrophila fluoride riboswitch was generated from PDB ID: 4ENC at 2.3 Å resolution in the ligand bound state. The fluoride ion shown by a red ball and directly-coordinated metal ions shown by green balls. Additional available structures that have been solved and detailed information are accessible on Structures page [3].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Thermotoga petrophila fluoride riboswitch generated from PDB ID: 4ENC at 2.3 Å resolution. The fluoride ion is labeled in red. Right: A close-up stereo view of the ligand-binding pocket, with the emphasis on the fluoride ion, three coordinating metal ions and five inwardly-pointing backbone phosphates[3].

drawing drawing


Ligand recognition

The fluoride riboswitch from Thermotoga petrophila has affinity for fluoride and rejects other halogen anions (chloride, bromide, iodide), even when they are added at high concentrations. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2,4].

drawing



References

[1] Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes.
Weinberg, Z. et al.
Genome Biol. 11, R31 (2010).

[2] Widespread genetic switches and toxicity resistance proteins for fluoride.
Baker, J. L. et al.
Science 335, 233–235 (2012).

[3] Fluoride ion encapsulation by Mg2+ ions and phosphates in a fluoride riboswitch.
Ren, A., Rajashankar, K. R. & Patel, D. J.
Nature 486, 85–89 (2012).

[4] Structural stability, acidity, and halide selectivity of the fluoride riboswitch recognition site.
Chawla, M., Credendino, R., Poater, A., Oliva, R. & Cavallo, L.
J. Am. Chem. Soc. 137, 299–306 (2015).

[5] Cotranscriptional folding of a riboswitch at nucleotide resolution.
Watters, K. E., Strobel, E. J., Yu, A. M., Lis, J. T. & Lucks, J. B.
Nat. Struct. Mol. Biol. 23, 1124–1131 (2016).

[6] An excited state underlies gene regulation of a transcriptional riboswitch.
Zhao, B., Guffy, S. L., Williams, B. & Zhang, Q.
Nat. Chem. Biol. 13, 968–974 (2017).

[7] Point-of-Use Detection of Environmental Fluoride a Cell-Free Riboswitch-Based Biosensor.
Thavarajah, W. et al.
ACS Synth. Biol. 9, 10–18 (2020).

[8] A fluoride-responsive genetic circuit enables in vivo biofluorination in engineered Pseudomonas putida.
Calero, P. et al.
Nat. Commun. 11, 5045 (2020).

[9] Dynamic competition between a ligand and transcription factor NusA governs riboswitch-mediated transcription regulation.
Chauvier, A., Ajmera, P., Yadav, R. & Walter, N. G.
Proc. Natl. Acad. Sci. U. S. A. 118, (2021).

[10] An anionic ligand snap-locks a long-range interaction in a magnesium-folded riboswitch.
Yadav, R., Widom, J. R., Chauvier, A. & Walter, N. G.
Nat. Commun. 13, 207 (2022).

[11] FluorMango, an RNA-Based Fluorogenic Biosensor for the Direct and Specific Detection of Fluoride.
Husser, C., Vuilleumier, S. & Ryckelynck, M.
Small 19, e2205232 (2023).