Rfam ID: RF00234 (glmS glucosamine-6-phosphate activated ribozyme)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2004[1] Discovery of the GlcN6P riboswitch

    The gene regulation model of the GlcN6P riboswitch 2004[2]

    2006[3] The putative pseudoknot structure

    The refined secondary structure model and the roles of metal ions 2006[4]

    2006[5] Location of ligand-binding site

    Crystal structures of the GlcN6P riboswitch in precleavage and postcleavage states, respectively 2006[6]

    2007[7] Crystal structure and regulatory mechanism

    The key features of the mechanism for genetic control 2007[8]

    2009[9] Crystal structure and chemical basis for activation

    Integration of signals from activating and inhibitory metabolites to modulate gene expression 2011[10]

    2012[11] The GlcN6P cofactor is a general acid-base catalyst

    The variety of catalytic roles of GlcN6P cofactor 2017[12]

    2019[13] Gene association

    As a target for antibacterial drug development 2021[14]

2023...



Description

The glucosamine-6-phosphate riboswitch ribozyme (glmS ribozyme) is an RNA structure that resides in the 5' untranslated region (UTR) of the mRNA transcript of the glmS gene. This RNA regulates the glmS gene by responding to concentrations of a specific metabolite, glucosamine-6-phosphate (GlcN6P), in addition to catalyzing a self-cleaving chemical reaction upon activation. This cleavage leads to the degradation of the mRNA that contains the ribozyme, and lowers production of GlcN6P. The glmS gene encodes for an enzyme glutamine-fructose-6-phosphate amidotransferase, which catalyzes the formation of GlcN6P, a compound essential for cell wall biosynthesis, from fructose-6-phosphate and glutamine. Thus, when GlcN6P levels are high, the glmS ribozyme is activated and the mRNA transcript is degraded but in the absence of GlcN6P the gene continues to be translated into glutamine-fructose-6-phosphate amidotransferase and GlcN6P is produced. GlcN6P is a cofactor for this cleavage reaction, as it directly participates as an acid-base catalyst. This RNA is the first riboswitch also found to be a self-cleaving ribozyme and, like many others, was discovered using a bioinformatics approach (from wikipedia).


Gene association

Inhibition of the synthesis of glucosamine-6-phosphate in human pathogenic bacteria. Three major routes are illustrated, the blocking of which would lead to inhibition of glucosamine-6-phosphate synthesis. In the simultaneous blocking of the GlmS and nagA, which is controlled by the GlcN6P riboswitch, blockade of GlcNc-6-P synthesis within the cell will be observed[13].</p></font>

drawing


> Gene regulation

Schematic representation of the mechanism of gene regulation by the GlcN6P riboswitch in Bacillus subtilis. The GlcN6P riboswitch is located on the glmS mRNA. The glmS mRNA translate the protein Glucosmine-6-phosphate synthetase (GlmS). GlmS catalyzes conversion of fructose-6-phosphate (Fru6P) and glutamine (Gln) into glutamate (Glu) and glucosamine-6-phosphate (GlcN6P). When GlcN6P accumulates cytoplasmically, it binds to the GlcN6P riboswitch domain, activating a latent self-cleavage activity. A portion of the 5′ UTR of the glmS gene was cleaved off, leading to reduced expression (gray X) of the GlmS protein. This feedback loop allows for fine-tuned regulation of GlcN6P synthesis in response to cellular needs. We present the prototypical mechanism, but not all possible mechanisms[2].

drawing


Structure and Ligand recognition

> 2D representation

Top: Consensus sequence and secondary structure model for the thermoanaerobacter tengcongensis GlcN6P riboswitch. Bottom: Secondary structure depictions of the thermoanaerobacter tengcongensis GlcN6P riboswitch according to PDB ID: 2H0Z[6].</p></font>

5'AGCGCCUGGACUUAAAGCCAUUGCACU3'. 5'CCGGCUUUAAGUUGACGAGGGCAGGGUUUAUCGAGACAUCGGCGGGUGCCCUGCGGUCUUCCUGCGACCGUUAGAGGACUGGUAAAACCACAGGCGACUGUGGCAUAGAGCAGUCCGGGCAGGAA3' (Sequence from bottom structure )



> 3D visualisation The overall structure of the thermoanaerobacter tengcongensis GlcN6P riboswitch was generated based on PDB ID: 2H0Z, which was resolved at 2.7 Å resolution and bound with glucose-6-phosphate (G6P) and Mg2+. In the structure model, glucose-6-phosphate (depicted in sticks) and Mg2+ (depicted in sphere) were highlighted in red. Additional available structures that have been solved and detailed information are accessible on Structures page [6].</font>

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






> Binding pocket

Left: Surface representation of the binding pocket of the thermoanaerobacter tengcongensis GlcN6P riboswitch generated from PDB ID: 2H0Z at 2.10 Å resolution. The glucose-6-phosphate (G6P, depicted in sticks) and Mg2+ (M depicted in sphere) were highlighted in red. Right: The hydrogen bonds of the binding sites of the GlcN6P riboswitch bound with G6P, M[6].</p></font>

drawing drawing


> Ligand recognition

Chemical structures of the glucosamine-6-phosphate (GlcN6P) and other cofactors that reaction with the GlcN6P riboswitch. The apparent equilibrium dissociation constants (Kd,app) of each compound is shown on bottom at pH 7.5 and 25 °C. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[11].

drawing


References

[1] Control of gene expression by a natural metabolite-responsive ribozyme.
Winkler, W. C., Nahvi, A., Roth, A., Collins, J. A. & Breaker, R. R.
Nature 428, 281–286 (2004).
[2] Ribozyme déjà vu.
Knudsen, S. M. & Ellington, A. D.
Nat. Struct. Mol. Biol. 11, 301–303 (2004).
[3] Core requirements for glmS ribozyme self-cleavage reveal a putative pseudoknot structure.
Soukup, G. A.
Nucleic Acids Res. 34, 968–975 (2006).
[4] Characteristics of the glmS ribozyme suggest only structural roles for divalent metal ions.
Roth, A., Nahvi, A., Lee, M., Jona, I. & Breaker, R. R.
Rna 12(4):607–619.(2006).
[5] Backbone and nucleobase contacts to glucosamine-6-phosphate in the glmS ribozyme.
Jansen, J. A., McCarthy, T. J., Soukup, G. A. & Soukup, J. K.
Nat. Struct. Mol. Biol. 13, 517–523 (2006).
[6] Structural basis of glmS ribozyme activation by glucosamine-6-phosphate.
Klein, D. J. & Ferré-D’Amaré, A. R.
Science 313, 1752–1756 (2006).
[7] Structural Investigation of the GlmS Ribozyme Bound to Its Catalytic Cofactor.
Cochrane, J. C., Lipchock, S. V. & Strobel, S. A.
Chem. Biol. 14, 97–105 (2007).
[8] Mechanism of mRNA destabilization by the glmS ribozyme.
Collins, J. A., Irnov, I., Baker, S. & Winkler, W. C.
Genes Dev. 21, 3356–3368 (2007).
[9] Structural and chemical basis for glucosamine 6-phosphate binding and activation of the glmS ribozyme.
Cochrane, J. C., Lipchock, S. V., Smith, K. D. & Strobel, S. A.
Biochemistry 48, 3239–3246 (2009).
[10] The glmS riboswitch integrates signals from activating and inhibitory metabolites in vivo.
Watson, P. Y. & Fedor, M. J.
Nat. Struct. Mol. Biol. 18, 359–363 (2011).
[11] The glmS ribozyme cofactor is a general acid-base catalyst.
Viladoms, J. & Fedor, M. J.
J. Am. Chem. Soc. 134, 19043–19049 (2012).
[12] The GlcN6P cofactor plays multiple catalytic roles in the glmS ribozyme.
Bingaman, J. L. et al.
Nat. Chem. Biol. 13, 439–445 (2017).
[13] Genome-wide bioinformatics analysis of FMN, SAM-I, glmS, TPP, lysine, purine, cobalamin, and SAH riboswitches for their applications as allosteric antibacterial drug targets in human pathogenic bacteria.
Pavlova, N. & Penchovsky, R.
Expert Opin. Ther. Targets 23, 631–643 (2019).
[14] Targeting glmS Ribozyme with Chimeric Antisense Oligonucleotides for Antibacterial Drug Development.
Traykovska, M., Popova, K. B. & Penchovsky, R.
ACS Synth. Biol. 10, 3167–3176 (2021).