Rfam ID: RF01739 (Glutamine riboswitch)
RF01704 (Glutamine-II riboswitch (downstream peptide RNA))
Click the buttons to navigate to different sections:
Timeline
Description
Both Downstream-peptide RNAs and glnA RNAs selectively bind glutamine. glnA RNAs and Downstream-peptide RNAs were later named Glutamine-I and Glutamine-II riboswitch. The glutamine riboswitch (formerly glnA RNA motif) is a conserved RNA structure that was predicted by bioinformatics. It is present in a variety of lineages of cyanobacteria, as well as some phages that infect cyanobacteria. It is also found in DNA extracted from uncultivated bacteria living in the ocean that are presumably species of cyanobacteria. glnA RNAs are found in the presumed 5' untranslated regions of genes encoding multiple classes of protein that are involved in nitrogen metabolism. The most prominent of these protein classes are ammonium transporters, the enzymes glutamine synthetase and glutamate synthase and PII protein, which itself regulates nitrogen metabolism. The Downstream-peptide motif refers to a conserved RNA structure identified by bioinformatics in the cyanobacterial genera Synechococcus and Prochlorococcus and one phage that infects such bacteria. It was also detected in marine samples of DNA from uncultivated bacteria, which are presumably other species of cyanobacteria. Downstream-peptide RNAs are found upstream of short open reading frames (ORFs) that are predicted to encode short peptides (usually between 17 and 100 amino acids). One of the ORFs is apparently down-regulated when cells are grown with an insufficient supply of nitrogen sources. The Downstream-peptide motif has a structural resemblance to a different candidate RNA structure called the glnA RNA motif which was shown to be a functional glutamine binding riboswitch in cyanobacteria. The most striking similarity is the nucleotide conservation within the P1 stem of both motifs (From Wikipedia).Gene association
The pathway of glutamine riboswitches regulating glutamine synthesis in Synechocystis[3].
|
|
Gene regulation
Potential mechanism of translation regulation by the glutamine-I riboswitch in Synechocystis and the glutamine-II riboswitch in Prochlorococcus sp. RBS denotes ribosome binding site. We present the prototypical mechanism, but not all possible mechanisms[3,4].
|
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the Glutamine-I riboswitch. Bottom: Secondary structure depictions of the Glutamine-I riboswitch in S. elongatus according to PDB ID: 5DDR[2].
5'CGUUGACCCAGGAAACUGGGCGGAAGUAAGGUCCAUUGCACUCCGGGCCUGAAGCAACGCG3' (Sequence from bottom structure )
Top: Consensus sequence and secondary structure model for the Glutamine-II riboswitch. Bottom: Secondary structure depictions of the Glutamine-II riboswitch in Prochlorococcus sp according to PDB ID: 6QN3[4].
5'CGUUCACCCUUCGGGGCGCAUGAAAUGGGAGUAGGGAACGGGAUUCUCAU3' (Sequence from bottom structure )
The overall structure of the Glutamine-I riboswitch in S. elongatus was generated from PDB ID: 5DDR at 2.60 Å resolution bound with glutamine. Glutamine (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [2].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
(Left)Surface representation of the binding pocket of the glutamine-I riboswitch in S. elongatus generated from PDB ID:5DDR at 2.60 Å. Glutamine (shown in sticks) is labeled in red. (Right) The hydrogen bonds of the binding site of the glutamine-I riboswitch bound with glutamine[2].
(Left) Surface representation of the binding pocket of the glutamine-II riboswitch in Prochlorococcus sp generated from PDB ID: 6QN3 at 2.30 Å. Glutamine (shown in sticks) is labeled in red. (Right) The hydrogen bonds of the binding site of the glutamine-II riboswitch bound with glutamine[4].
Ligand recognition
Chemical structures of glutamine and its analogs. The apparent KD of each compound of glutamine-I and glutamine-II riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[1].
|
|
References
[1] Bacterial aptamers that selectively bind glutamine
Ames, T. D. & Breaker, R. R.
RNA Biol. 8, (2011).
[2] Structural and Dynamic Basis for Low-Affinity, High-Selectivity Binding of L-Glutamine by the Glutamine Riboswitch
Ren, A. et al.
Cell Rep. 13, (2015).
[3] A glutamine riboswitch is a key element for the regulation of glutamine synthetase in cyanobacteria
Klähn, S. et al.
Nucleic Acids Res. 46, (2018).
[4] Structure and ligand binding of the glutamine-II riboswitch
Huang, L., Wang, J., Watkins, A. M., Das, R. & Lilley, D. M. J.
Nucleic Acids Res. 47, (2019).