Rfam ID: RF00504 (Glycine riboswitch)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2004[1] The discovery of glycine riboswitch

    The chemical basis of glycine riboswitch cooperativity 2008[3]

    2010[4] The crystal structures of glycine-free and glycine-bound glycine riboswitch

    Mg2+, Ca2+ and Mn2+ facilitate glycine binding 2010[5]

    2011[6] The crystal structure of cooperative ligand binding by the tandem glycine riboswitch

    The binding of glycine to the second aptamer facilitates binding of a second glycine molecule to the first aptamer 2011[7]

    2012[8] There is no ligand-binding cooperativity in the tandem glycine riboswitch when the leader–linker interaction is present

    Ligand binding by the glycine riboswitch depends on aptamer dimerization but not double ligand occupancy 2014[9]

    2016[10] The engineering of fluorogenic glycine riboswitches

    The discovery of singlet glycine riboswitch with one aptamer domain 2016[11]

    2017[12]In vivo behavior of the tandem glycine riboswitch

    The engineering of a glycine riboswitch to control a novel metabolic pathway for 5‑aminolevulinic acid production in Escherichia coli2019[14]

    2020[15] The cryo-EM three-dimensional structures of glycine riboswitch

    Tandem ON switch preferentially utilize binding to the first aptamer to promote helical switching, while OFF switch variants favor binding to the second aptamer 2020[16]

    2022[17] The synthetic glycine-ON and -OFF riboswitches for metabolic regulation in Escherichia coli

2023...



Description

The bacterial glycine riboswitch is an RNA element that can bind the amino acid glycine. Glycine riboswitches usually consist of two metabolite-binding aptamer domains with similar structures in tandem. The aptamers were originally thought to cooperatively bind glycine to regulate the expression of downstream genes. In Bacillus subtilis, this riboswitch is found upstream of the gcvT operon which controls glycine degradation. It is thought that when glycine is in excess it will bind to both aptamers to activate these genes and facilitate glycine degradation (From Wikipedia).


Gene regulation

Potential mechanism of translation regulation by glycine riboswitch in Fusobacterium nucleatum. We present the prototypical mechanism, but not all possible mechanisms[1,9].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for glycine riboswitch. Bottom: Secondary structure depictions of glycine riboswitch in V. cholerae according to PDB ID: 3OWZ[1,4].

5'GGCUCUGGAGAGAACCGUUUAAUCGGUCGCCGAAGGAGCAAGCUCUGCGGAAACGCAGAGUGAAACUCUCAGGCAAAAGGACAGAGUC3' (Sequence from bottom structure )



3D visualisation

The overall structure of glycine riboswitch in V. cholerae was generated from PDB ID: 3OWZ at 2.95 Å resolution bound with glycine. Glycine (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [4].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

(Left) Surface representation of the binding pocket of glycine riboswitch in V. cholerae generated from PDB ID: 3OWZ at 2.95 Å. Lysine (shown in sticks) is labeled in red. (Right) The hydrogen bonds of the binding site of glycine riboswitch bound with glycine[4].

drawing drawing


Ligand recognition

Chemical structures of glycine and its analogs. The apparent KD of each compound of glycine riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[1].

drawing



References

[1] A glycine-dependent riboswitch that uses cooperative binding to control gene expression
Mandal, M. et al.
Science 306, 275–279 (2004).

[2] Structural transitions and thermodynamics of a glycine-dependent riboswitch from Vibrio cholerae
Lipfert, J. et al.
J. Mol. Biol. 365, 1393–1406 (2007).

[3] Chemical basis of glycine riboswitch cooperativity
Kwon, M. & Strobel, S. A.
RNA 14, 25–34 (2008).

[4] Structural insights into ligand recognition by a sensing domain of the cooperative glycine riboswitch
Huang, L., Serganov, A. & Patel, D. J.
Mol. Cell 40, 774–786 (2010).

[5] Dissecting electrostatic screening, specific ion binding, and ligand binding in an energetic model for glycine riboswitch folding
Lipfert, J., Sim, A. Y. L., Herschlag, D. & Doniach, S.
RNA 16, 708–719 (2010).

[6] Structural basis of cooperative ligand binding by the glycine riboswitch
Butler, E. B., Xiong, Y., Wang, J. & Strobel, S. A.
Chem. Biol. 18, 293–298 (2011).

[7] Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
Erion, T. V. & Strobel, S. A.
RNA 17, 74–84 (2011).

[8] An energetically beneficial leader-linker interaction abolishes ligand-binding cooperativity in glycine riboswitches
Sherman, E. M., Esquiaqui, J., Elsayed, G. & Ye, J.-D.
RNA 18, 496–507 (2012).

[9] Ligand binding by the tandem glycine riboswitch depends on aptamer dimerization but not double ligand occupancy
Ruff, K. M. & Strobel, S. A.
RNA 20, 1775–1788 (2014).

[10] Engineering and characterization of fluorogenic glycine riboswitches
Ketterer, S., Gladis, L., Kozica, A. & Meier, M.
Nucleic Acids Res. 44, 5983–5992 (2016).

[11] Singlet glycine riboswitches bind ligand as well as tandem riboswitches
Ruff, K. M., Muhammad, A., McCown, P. J., Breaker, R. R. & Strobel, S. A.
RNA 22, 1728–1738 (2016).

[12] In Vivo Behavior of the Tandem Glycine Riboswitch in Bacillus subtilis
Babina, A. M., Lea, N. E. & Meyer, M. M.
MBio 8, (2017).

[13] A Glycine Riboswitch in Controls Expression of a Sodium:Alanine Symporter Family Protein Gene
Khani, A., Popp, N., Kreikemeyer, B. & Patenge, N.
Front. Microbiol. 9, 200 (2018).

[14] Characterization and Engineering of a Clostridium Glycine Riboswitch and Its Use To Control a Novel Metabolic Pathway for 5-Aminolevulinic Acid Production in Escherichia coli
Zhou, L. et al.
ACS Synth. Biol. 8, 2327–2335 (2019).

[15] Accelerated cryo-EM-guided determination of three-dimensional RNA-only structures
Kappel, K. et al.
Nat. Methods 17, 699–707 (2020).

[16] The asymmetry and cooperativity of tandem glycine riboswitch aptamers
Torgerson, C. D., Hiller, D. A. & Strobel, S. A.
RNA 26, 564–580 (2020).

[17] Development and characterization of a glycine biosensor system for fine-tuned metabolic regulation in Escherichia coli
Hong, K.-Q., Zhang, J., Jin, B., Chen, T. & Wang, Z.-W.
Microb. Cell Fact. 21, 56 (2022).