Rfam ID: RF00442 (Guanidine-I riboswitch)
RF01068 (Guanidine-II riboswitch)
RF01763 (Guanidine-III riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
Four classes of riboswitches have been identified that bind the cationic molecule guanidine (Gdm+ ). The ykkC motif RNA is associated with genes encoding transporters, such as multidrug efflux pumps, urea carboxylase, purine biosynthesis, and amino acid metabolism enzymes. Later, transporters and urea carboxylase were also found to be associated with the mini-ykkC and ykkC-III motifs. They sense the same ligand guanidine, now known as guanidine-I, -II and -III riboswitches. It was later discovered that the guanidine-IV riboswitch was shown to selectively respond to guanidine. Guanidine-I and -IV are transcriptional regulatory riboswitches, while guanidine-II and -III are considered translational riboswitches[1-3,10].Gene association
Guanidine is sensed by at least four different classes of riboswitches that are ubiquitous in bacteria(including Raoultella terrigena, Erwinia rhapontici and Klebsiella michiganensis). The genes primarily regulated by the guanidine riboswitch are Gdx transporters that export compounds from bacterial cells. In addition, urea/guanidine carboxylase and related hydrolases, as well as ABC transporters, are often incorporated in guanidine-inducible operons[13].
|
|
Gene regulation
Guanidine-I is a transcriptionally regulated riboswitch widely present in bacteria, and may form a strong intrinsic termination stem, but ligand binding results in a stable aptamer structure that prevents terminator formation. Guanidine-II differs from guanidine-I in its gene regulatory mechanism. Guanidine-II appears to act as a translational riboswitch and is predominantly found in Proteobacteria. Guanidine stabilizes the loop–loop interaction of the ON state that competes with the OFF structure where a SDS is sequestered in base-pairs. We present the prototypical mechanism, but not all possible mechanisms[1-2].
|
|
|
Guanidine-III is a translational riboswitch and is predominantly found in Actinobacteria. Increased stability in the presence of guanidine is necessary for switching to the ON conformation. Guanidine-IV riboswitch is transcriptional regulatory riboswitch in Clostridium botulinum. Acts as a genetic "ON" switch, where the ligand-binding structure and the terminator stem will be mutually exclusive structures. We present the prototypical mechanism, but not all possible mechanisms[3,11].
|
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the guanidine-I riboswitch. Bottom: Secondary structure depictions of the Sulfobacillus acidophilus guanidine-I riboswitch according to PDB ID: 5T83[4].
5'GUCUAAAGUUUGCUAGGGUUCCGCGUCAUAGGUGGUCUGGUCCAAGAGCAAACGGCUUUCACAAAGCCACACGGAAGGAUAAAAGCCUGGGAGAU3' (Sequence from bottom structure )
Top: Consensus sequence and secondary structure model for the guanidine-II riboswitch. Bottom: Secondary structure depictions of the Gloeobacter violaceus guanidine-II riboswitch P1 stem-loop according to PDB ID: 5NOM and P2 stem-loop according to PDB ID: 5NDH[6].
5'GGUGGGGACGACCCCACC3'. 5'GCGGGGACGACCCCGC3' (Sequence from bottom structure )
Top: Consensus sequence and secondary structure model for the guanidine-III riboswitch. Bottom: Secondary structure depictions of the Thermobifida fusca guanidine-III riboswitch according to PDB ID: 5NWQ[7].
5'CCGGACGAGGUGCGCCGUACCCGGUCAGGACAAGACGGCGC3' (Sequence from bottom structure )
Consensus sequence and secondary structure model for the guanidine-IV riboswitch[8].
|
|
The overall structure of the Sulfobacillus acidophilus guanidine-I riboswitch was generated from PDB ID: 5T83 at 2.71 Å resolution bound with guanidine. Guanidine (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [4].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Sulfobacillus acidophilus guanidine-I riboswitch generated from PDB ID: 5T83 at 2.71 Å resolution. Guanidine (shown in sticks) is labeled in red. Right: Ligand interaction between guanidine and guanidine-I riboswitch[4].
Left: Surface representation of the binding pocket of the Gloeobacter violaceus guanidine-II riboswitch generated from PDB ID: 5NOM at 1.93 Å resolution, 5NDH at 1.81 Å resolution. Guanidine (shown in sticks) is labeled in red. Right: Ligand interaction between guanidine and guanidine-II riboswitch[6].
Left: Surface representation of the binding pocket of the Thermobifida fusca guanidine-III riboswitch generated from PDB ID: 5NWQ at 1.91 Å resolution. Guanidine (shown in sticks) is labeled in red. Right: Ligand interaction between guanidine and guanidine-III riboswitch[7].
Ligand recognition
Chemical structures of xanthine and its analogs. The apparent KD of each compound of guanidine-I, -II, -III, -IV riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[1-3,11].
|
|
References
[1] Metabolism of Free Guanidine in Bacteria Is Regulated by a Widespread Riboswitch Class.
Nelson, J. W., Atilho, R. M., Sherlock, M. E., Stockbridge, R. B. & Breaker, R. R.
Mol. Cell 65, 220–230 (2017).
[2] Biochemical Validation of a Second Guanidine Riboswitch Class in Bacteria.
Sherlock, M. E., Malkowski, S. N. & Breaker, R. R.
Biochemistry 56, 352–358 (2017).
[3] Biochemical Validation of a Third Guanidine Riboswitch Class in Bacteria.
Sherlock, M. E. & Breaker, R. R.
Biochemistry 56, 359–363 (2017).
[4] Structural Basis for Ligand Binding to the Guanidine-I Riboswitch.
Reiss, C. W., Xiong, Y. & Strobel, S. A.
Structure 25, 195–202 (2017).
[5] ykkCStructural basis for guanidine sensing by the family of riboswitches.
Battaglia, R. A., Price, I. R. & Ke, A.
RNA 23, 578–585 (2017).
[6] The Structure of the Guanidine-II Riboswitch.
Huang, L., Wang, J. & Lilley, D. M. J.
Cell Chem Biol 24, 695–702.e2 (2017).
[7] Structural basis for ligand binding to the guanidine-II riboswitch.
Reiss, C. W. & Strobel, S. A.
RNA 23, 1338–1343 (2017).
[8] Structure of the Guanidine III Riboswitch.
Huang, L., Wang, J., Wilson, T. J. & Lilley, D. M. J.
Cell Chem Biol 24, 1407–1415.e2 (2017).
[9] Structure-guided design of a high-affinity ligand for a riboswitch.
Huang, L., Wang, J., Wilson, T. J. & Lilley, D. M. J.
RNA 25, 423–430 (2019).
[10] Do the P1 and P2 hairpins of the Guanidine-II riboswitch interact?
Wuebben, C., Vicino, M. F., Mueller, M. & Schiemann, O.
Nucleic Acids Res. 48, 10518–10526 (2020).
[11] Biochemical Validation of a Fourth Guanidine Riboswitch Class in Bacteria.
Salvail, H., Balaji, A., Yu, D., Roth, A. & Breaker, R. R.
Biochemistry 59, 4654–4662 (2020).
[12] Discovery and characterization of a fourth class of guanidine riboswitches.
Lenkeit, F., Eckert, I., Hartig, J. S. & Weinberg, Z.
Nucleic Acids Res. 48, 12889–12899 (2020).
[13] Widespread bacterial utilization of guanidine as nitrogen source.
Sinn, M., Hauth, F., Lenkeit, F., Weinberg, Z. & Hartig, J. S.
Mol. Microbiol. 116, 200–210 (2021).
[14] Combining Coarse-Grained Simulations and Single Molecule Analysis Reveals a Three-State Folding Model of the Guanidine-II Riboswitch.
Fuks, C., Falkner, S., Schwierz, N. & Hengesbach, M.
Front Mol Biosci 9, 826505 (2022).