Rfam ID: RF00167 (Purine riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
The guanine riboswitch selectively recognizes guanine and contains a cytosine ribonucleotide in a specific position of the guanine-binding aptamer domain. Now two classes of guanine riboswitches have been discovered, most commonly associated with genes encoding phosphoribosyltransferase (PRT) enzymes. Although these two classes of guanine riboswitches have the similar secondary structure, the directionalities of gene control upon ligand binding are predicted to be opposite for the guanine-I (OFF) and guanine-II (ON) riboswitches.Gene association
The guanine-I riboswitch, once thought to be an operon, was originally found in the 5'-UTR of xpt-pbuX gene from Bacillus subtilis. The xpt gene and pbuX gene encode a specific xanthine phosphoribosyl-transferase and a xanthine-specific purine permease respectively, and the genes have overlapping coding regions. The guanine-I riboswitch was also identified in other Bacillus subtilis genes (purE, yxjA et.al.) and also in other bacterial species. However, the nucleobase specificities for many annotated PRT enzymes downstream of guanine-II riboswitch of Paenibacillus sp. have not been established[1,2,9].
|
|
Gene regulation
(left) The Bacillus subtilis guanine-I riboswitch has been shown to control gene expression through transcriptional termination. It forms an antiterminator in the absence of guanine, thereby allowing RNA transcription elongation to proceed to completion. The presence of guanine results in stabilization of the aptamer domain, thereby facilitating terminator formation and shutting down transcription. (right) Sequence and secondary structure model of a guanine-II riboswitch of Paenibacillus sp. is consistent with a genetic “ON” switch wherein ligand binding would preclude formation of the terminator stem[2, 4].
|
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and structural model for guanine-I riboswitch. Bottom: Sequence and secondary structure model of the Bacillus subtilis guanine-I riboswitch according to PDB ID:1Y27[3].
5'GGAUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGGUC3' (Sequence from bottom structure )
Consensus sequence and structural model for guanine-II riboswitch[9].
|
|
The overall structure of the Bacillus subtilis guanine-I riboswitch was generated from PDB ID:1Y27 at 2.40Å resolution bound with guanine. Guanine (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [4].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Hydrogen-bonding alignments to bound guanine in the Bacillus subtilis guanine-I riboswitch, generated from PDB ID:1Y27 at 2.40Å. The bound guanine forms a Watson-Crick pair with C74. Hydrogen bonds involving 2'-OH of U22 and base edges of U47 and U51 are common to both riboswitches[4].
Ligand recognition
Chemical structures of guanine and its various analogs. The apparent KD of each compound of guanine-I riboswitch and partial compounds of guanine-II riboswitch are shown on bottom. G-I, guanine-I riboswitch. G-II, guanine-II riboswitch. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2,9].
|
|
References
[1] Xanthine metabolism in Bacillus subtilis: characterization of the xpt-pbuX operon and evidence for purine- and nitrogen-controlled expression of genes involved in xanthine salvage and catabolism.
Christiansen, L. C., Schou, S., Nygaard, P. & Saxild, H. H.
J. Bacteriol. 179, (1997).
[2] Riboswitches Control Fundamental Biochemical Pathways in Bacillus subtilis and Other Bacteria.
Mandal, M., Boese, B., Barrick, J. E., Winkler, W. C. & Breaker, R. R.
Cell 113, (2003).
[3] Structure of a natural guanine-responsive riboswitch complexed with the metabolite hypoxanthine.
Batey, R. T., Gilbert, S. D. & Montange, R. K.
Nature 432, (2004).
[4] Structural Basis for Discriminative Regulation of Gene Expression by Adenine- and Guanine-Sensing mRNAs.
Serganov, A. et al.
Chem. Biol. 11, (2004).
[5] Thermodynamic and Kinetic Characterization of Ligand Binding to the Purine Riboswitch Aptamer Domain.
Gilbert, S. D., Stoddard, C. D., Wise, S. J. & Batey, R. T.
J. Mol. Biol. 359, (2006).
[6] Adaptive Ligand Binding by the Purine Riboswitch in the Recognition of Guanine and Adenine Analogs.
Gilbert, S. D., Reyes, F. E., Edwards, A. L. & Batey, R. T.
Structure 17, (2009).
[7] Influence of ground-state structure and Mg 2+ binding on folding kinetics of the guanine-sensing riboswitch aptamer domain.
Buck, J. et al.
Nucleic Acids Res. 39, (2011).
[8] A Crystal Structure of a Functional RNA Molecule Containing an Artificial Nucleobase Pair.
Hernandez, A. R. et al.
Angew. Chem. Int. Ed Engl. 54, (2015).
[9] Variants of the guanine riboswitch class exhibit altered ligand specificities for xanthine, guanine, or 2′-deoxyguanosine.
Hamal, D. S., Panchapakesan, S. S. S., Slattery, P., Roth, A. & Breaker, R. R.
Proc. Natl. Acad. Sci. U. S. A. 119, (2022).