Rfam ID: RF00168 (Lysine riboswitch)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2003[1] Discovery of lysine riboswitch

    Discovery of lysine riboswitch 2003[2]

    2003[3] The regulation mechanism of lysine riboswitch

    A loop–loop interaction and a K-turn motif are important 2007[4]

    2007[5] Several lysine analogs binding riboswitches in vitro inhibit Bacillus subtilis growth

    Structure of lysine riboswitch 2008[6]

    2008[7] Structure of lysine riboswitch

    The interaction of Helix P2–loop L4 is particularly important 2011[8]

    2012[9] The lysine riboswitch is highly sensitive to the precise placement of the ε-amino group

    Rationally-designed fluorescent lysine riboswitch probes 2012[10]

    2012[11] The structural elements of the lysine molecule required for recognition

    The engineering of a lysine-ON riboswitch for metabolic control in Corynebacterium glutamicum2015[12]

    2015[13] The use of lysine riboswitch binding L-lysine to control the competing metabolic bypathways of lysine biosynthesis

    Lysine binding residues in the global folding of the lysC riboswitch is important 2015[14]

    2020[16] Found trimethylamine N-oxide (TMAO) can stabilize the lysine riboswitch by single molecule FRET (smFRET) microscopy

    K+ is optimally suited for bridging interactions between lysine and the riboswitch 2023[17]

2023...



Description

The Lysine riboswitch is a metabolite binding RNA element found within certain messenger RNAs that serve as a precision sensor for the amino acid lysine. Allosteric rearrangement of mRNA structure is mediated by ligand binding, and this results in modulation of gene expression. Lysine riboswitch are most abundant in Bacillota and Gammaproteobacteria where they are found upstream of a number of genes involved in lysine biosynthesis, transport and catabolism. The lysine riboswitch has also been identified independently and called the L box (From Wikipedia).


Gene association

The pathway of lysine riboswitches regulating lysine synthesis in B. subtilis[2].

drawing


Gene regulation

Potential mechanism of translation regulation by lysine riboswitch in B. subtilis (Top) and E. coli (Bottom). RBS denotes ribosome binding site. We present the prototypical mechanism, but not all possible mechanisms[2,3].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for lysine riboswitch. Bottom: Secondary structure depictions of lysine riboswitch in T. maritima according to PDB ID: 3DIL[1,7].

5'GGCCGACGGAGGCGCGCCCGAGAUGAGUAGGCUGUCCCAUCAGGGGAGGAAUCGGGGACGGCUGAAAGGCGAGGGCGCCGAAGGGUGCAGAGUUCCUCCCGCUCUGCAUGCCUGGGGGUAUGGGGAAUACCCAUACCACUGUCACGGAGGUCUCUCCGUGGAGAGCCGUCGGUC3' (Sequence from bottom structure )



3D visualisation

The overall structure of lysine riboswitch in T. maritima was generated from PDB ID: 3DIL at 1.90 Å resolution bound with lysine. Lysine (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [7].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

(Left) Surface representation of the binding pocket of lysine riboswitch in T. maritima generated from PDB ID: 3DIL at 1.90 Å. Lysine (shown in sticks) is labeled in red. (Right) The hydrogen bonds of the binding site of lysine riboswitch bound with lysine[7].

drawing drawing


Ligand recognition

Chemical structures of lysine and its analogs. The apparent KD of each compound of lysine riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[1,5].

drawing



References

[1] An mRNA structure in bacteria that controls gene expression by binding lysine
Sudarsan, N., Wickiser, J. K., Nakamura, S., Ebert, M. S. & Breaker, R. R.
Genes Dev. 17, 2688–2697 (2003).

[2] The L box regulon: lysine sensing by leader RNAs of bacterial lysine biosynthesis genes
Grundy, F. J., Lehman, S. C. & Henkin, T. M.
Proc. Natl. Acad. Sci. U. S. A. 100, 12057–12062 (2003).

[3] Regulation of lysine biosynthesis and transport genes in bacteria: yet another RNA riboswitch?
Rodionov, D. A., Vitreschak, A. G., Mironov, A. A.
Nucleic Acids Res. 31, 6748–6757 (2003).

[4] A loop loop interaction and a K-turn motif located in the lysine aptamer domain are important for the riboswitch gene regulation control
Blouin, S. & Lafontaine, D. A.
RNA 13, 1256–1267 (2007).

[5] Antibacterial lysine analogs that target lysine riboswitches
Blount, K. F., Wang, J. X., Lim, J., Sudarsan, N. & Breaker, R. R.
Nat. Chem. Biol. 3, 44–49 (2007).

[6] Crystal structure of the lysine riboswitch regulatory mRNA element
Garst, A. D., Héroux, A., Rambo, R. P. & Batey, R. T.
J. Biol. Chem. 283, 22347–22351 (2008).

[7] Structural insights into amino acid binding and gene control by a lysine riboswitch
Serganov, A., Huang, L. & Patel, D. J.
Nature 455, 1263–1267 (2008).

[8] Folding of the lysine riboswitch: importance of peripheral elements for transcriptional regulation
Blouin, S., Chinnappan, R. & Lafontaine, D. A.
Nucleic Acids Res. 39, 3373–3387 (2011).

[9] Insights into the regulatory landscape of the lysine riboswitch
Garst, A. D., Porter, E. B. & Batey, R. T.
J. Mol. Biol. 423, 17–33 (2012).

[10] Rationally-designed fluorescent lysine riboswitch probes
Budhathoki, P., Bernal-Perez, L. F., Annunziata, O. & Ryu, Y.
Org. Biomol. Chem. 10, 7872–7874 (2012).

[11] Analysis of lysine recognition and specificity of the Bacillus subtilis L box riboswitch
Wilson-Mitchell, S. N., Grundy, F. J. & Henkin, T. M.
Nucleic Acids Res. 40, 5706–5717 (2012).

[12] Engineering a Lysine-ON Riboswitch for Metabolic Control of Lysine Production in Corynebacterium glutamicum
Zhou, L.-B. & Zeng, A.-P.
ACS Synth. Biol. 4, 1335–1340 (2015).

[13] Exploring lysine riboswitch for metabolic flux control and improvement of L-lysine synthesis in Corynebacterium glutamicum
Zhou, L.-B. & Zeng, A.-P.
ACS Synth. Biol. 4, 729–734 (2015).

[14] Role of lysine binding residues in the global folding of the lysC riboswitch
Smith-Peter, E., Lamontagne, A.-M. & Lafontaine, D. A.
RNA Biol. 12, 1372–1382 (2015).

[15] Comparative genomics and phylogenomic analyses of lysine riboswitch distributions in bacteria
Mukherjee, S., Barash, D. & Sengupta, S.
PLoS One 12, e0184314 (2017).

[16] High pressure single-molecule FRET studies of the lysine riboswitch: cationic and osmolytic effects on pressure induced denaturation
Sung, H.-L. & Nesbitt, D. J.
Phys. Chem. Chem. Phys. 22, 15853–15866 (2020).

[17] Ionic Cooperativity between Lysine and Potassium in the Lysine Riboswitch: Single-Molecule Kinetic and Thermodynamic Studies
Marton Menendez, A. & Nesbitt, D. J.
J. Phys. Chem. B 127, 2430–2440 (2023).