Rfam ID: RF00168 (Lysine riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
The Lysine riboswitch is a metabolite binding RNA element found within certain messenger RNAs that serve as a precision sensor for the amino acid lysine. Allosteric rearrangement of mRNA structure is mediated by ligand binding, and this results in modulation of gene expression. Lysine riboswitch are most abundant in Bacillota and Gammaproteobacteria where they are found upstream of a number of genes involved in lysine biosynthesis, transport and catabolism. The lysine riboswitch has also been identified independently and called the L box (From Wikipedia).Gene association
The pathway of lysine riboswitches regulating lysine synthesis in B. subtilis[2].
|
|
Gene regulation
Potential mechanism of translation regulation by lysine riboswitch in B. subtilis (Top) and E. coli (Bottom). RBS denotes ribosome binding site. We present the prototypical mechanism, but not all possible mechanisms[2,3].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for lysine riboswitch. Bottom: Secondary structure depictions of lysine riboswitch in T. maritima according to PDB ID: 3DIL[1,7].
5'GGCCGACGGAGGCGCGCCCGAGAUGAGUAGGCUGUCCCAUCAGGGGAGGAAUCGGGGACGGCUGAAAGGCGAGGGCGCCGAAGGGUGCAGAGUUCCUCCCGCUCUGCAUGCCUGGGGGUAUGGGGAAUACCCAUACCACUGUCACGGAGGUCUCUCCGUGGAGAGCCGUCGGUC3' (Sequence from bottom structure )
The overall structure of lysine riboswitch in T. maritima was generated from PDB ID: 3DIL at 1.90 Å resolution bound with lysine. Lysine (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [7].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
(Left) Surface representation of the binding pocket of lysine riboswitch in T. maritima generated from PDB ID: 3DIL at 1.90 Å. Lysine (shown in sticks) is labeled in red. (Right) The hydrogen bonds of the binding site of lysine riboswitch bound with lysine[7].
Ligand recognition
Chemical structures of lysine and its analogs. The apparent KD of each compound of lysine riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[1,5].
|
|
References
[1] An mRNA structure in bacteria that controls gene expression by binding lysine
Sudarsan, N., Wickiser, J. K., Nakamura, S., Ebert, M. S. & Breaker, R. R.
Genes Dev. 17, 2688–2697 (2003).
[2] The L box regulon: lysine sensing by leader RNAs of bacterial lysine biosynthesis genes
Grundy, F. J., Lehman, S. C. & Henkin, T. M.
Proc. Natl. Acad. Sci. U. S. A. 100, 12057–12062 (2003).
[3] Regulation of lysine biosynthesis and transport genes in bacteria: yet another RNA riboswitch?
Rodionov, D. A., Vitreschak, A. G., Mironov, A. A.
Nucleic Acids Res. 31, 6748–6757 (2003).
[4] A loop loop interaction and a K-turn motif located in the lysine aptamer domain are important for the riboswitch gene regulation control
Blouin, S. & Lafontaine, D. A.
RNA 13, 1256–1267 (2007).
[5] Antibacterial lysine analogs that target lysine riboswitches
Blount, K. F., Wang, J. X., Lim, J., Sudarsan, N. & Breaker, R. R.
Nat. Chem. Biol. 3, 44–49 (2007).
[6] Crystal structure of the lysine riboswitch regulatory mRNA element
Garst, A. D., Héroux, A., Rambo, R. P. & Batey, R. T.
J. Biol. Chem. 283, 22347–22351 (2008).
[7] Structural insights into amino acid binding and gene control by a lysine riboswitch
Serganov, A., Huang, L. & Patel, D. J.
Nature 455, 1263–1267 (2008).
[8] Folding of the lysine riboswitch: importance of peripheral elements for transcriptional regulation
Blouin, S., Chinnappan, R. & Lafontaine, D. A.
Nucleic Acids Res. 39, 3373–3387 (2011).
[9] Insights into the regulatory landscape of the lysine riboswitch
Garst, A. D., Porter, E. B. & Batey, R. T.
J. Mol. Biol. 423, 17–33 (2012).
[10] Rationally-designed fluorescent lysine riboswitch probes
Budhathoki, P., Bernal-Perez, L. F., Annunziata, O. & Ryu, Y.
Org. Biomol. Chem. 10, 7872–7874 (2012).
[11] Analysis of lysine recognition and specificity of the Bacillus subtilis L box riboswitch
Wilson-Mitchell, S. N., Grundy, F. J. & Henkin, T. M.
Nucleic Acids Res. 40, 5706–5717 (2012).
[12] Engineering a Lysine-ON Riboswitch for Metabolic Control of Lysine Production in Corynebacterium glutamicum
Zhou, L.-B. & Zeng, A.-P.
ACS Synth. Biol. 4, 1335–1340 (2015).
[13] Exploring lysine riboswitch for metabolic flux control and improvement of L-lysine synthesis in Corynebacterium glutamicum
Zhou, L.-B. & Zeng, A.-P.
ACS Synth. Biol. 4, 729–734 (2015).
[14] Role of lysine binding residues in the global folding of the lysC riboswitch
Smith-Peter, E., Lamontagne, A.-M. & Lafontaine, D. A.
RNA Biol. 12, 1372–1382 (2015).
[15] Comparative genomics and phylogenomic analyses of lysine riboswitch distributions in bacteria
Mukherjee, S., Barash, D. & Sengupta, S.
PLoS One 12, e0184314 (2017).
[16] High pressure single-molecule FRET studies of the lysine riboswitch: cationic and osmolytic effects on pressure induced denaturation
Sung, H.-L. & Nesbitt, D. J.
Phys. Chem. Chem. Phys. 22, 15853–15866 (2020).
[17] Ionic Cooperativity between Lysine and Potassium in the Lysine Riboswitch: Single-Molecule Kinetic and Thermodynamic Studies
Marton Menendez, A. & Nesbitt, D. J.
J. Phys. Chem. B 127, 2430–2440 (2023).