Rfam ID: RF00380 (M-box riboswitch (ykoK leader))
RF01056 (Magnesium Sensor)
Click the buttons to navigate to different sections:
Timeline
Description
The Ykok leader or M-box is a Mg-sensing RNA structure that controls the expression of Magnesium ion transport proteins in bacteria. It is a distinct structure to the Magnesium responsive RNA element. The Ykok leader was originally described as a conserved sequence with potential riboswitch function found upstream of the B. subtilis ykoK gene and genes with related functions in other bacteria. Examples of the conserved M-box RNA structure occur upstream of each of the three major families of Mg transporters (CorA, MgtE and MgtA/MgtB) in various bacterial species. The molecular structure of the M-box example upstream of the B. subtilis ykoK gene includes six bound Mg ions. Biochemical studies indicate that this M-Box RNA compacts in the presence of Mg and other divalent ions. This folding process appears to disrupt an antiterminator structure, and thereby allow a transcription terminator structure to form. As expected from this model, B. subtilis cells repress expression of a downstream reporter gene when grown in the presence of Mg. Therefore, the M-box appears to function as a genetic "off" switch that is important for maintaining Mg homeostasis in bacteria. The Magnesium responsive RNA element, not to be confused with the completely distinct M-box riboswitch, is a cis-regulatory element that regulates the expression of the magnesium transporter protein MgtA. It is located in the 5' UTR of this gene. The mechanism for the potential magnesium-sensing capacity of this RNA is still unclear, though a recent report suggests that the RNA element targets the mgtA transcript for degradation by RNase E when cells are grown in high Mg environments (From Wikipedia).Gene association
Mg2+ riboswitch in Salmonella enterica. Magnesium-responsive regulatory pathways in the bacteria Salmonella enterica by the two-component regulatory system consisting of PhoQ, the membrane-bound sensor kinase, and PhoP, a transcription regulator. PhoP, which is phosphorylated, affects more than 100 genes in response to fluctuations in the Mg2+ concentration. The regulatory system PhoQ/PhoP is a two-component system activated in low magnesium levels or by cationic peptides. Genes regulated by PhoP-PhoQ are depicted in grey boxes and ovals[6].
|
|
Gene regulation
Potential mechanism of transcriptional regulation by the Mg2+-I in Bacillus subtilis and Mg2+-II riboswitch in Salmonella. The magnesium ions are showed on red. We present the prototypical mechanism, but not all possible mechanisms[2,5].
|
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the Mg2+-I riboswitch. Bottom: Secondary structure depictions of the B. subtilis Mg2+-I riboswitch according to PDB ID: 2QBZ. Secondary structure shows the positions of inner- and outer-sphere contacts using shaded and open symbols, respectively, for the six Mg2+ coordinated to the RNA. Each Mg2+ has a unique symbol denoted in the legend[3].
5'GGGCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAAUCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGGAUGCUUGUCCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAGCCCA3' (Sequence from bottom structure )
Left: Consensus sequence and secondary structure model for the Mg2+-II riboswitch.
|
|
The structure of the B. subtilis M-box riboswitch aptamer domain was generated from PDB ID: 2QBZ at 2.60 Å resolution. Six magnesiums are labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the B. subtilis Mg2+-I riboswitch generated from PDB ID: 2QBZ at 2.60 Å resolution. Magnesiums are labeled in red. Right: Nucleotides that contact Mg1-3 via inner and outer sphere interactions are labeled and shown as sticks[3].
References
[1] New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control.
Barrick, J. E. et al.
Proc. Natl. Acad. Sci. U. S. A. 101, 6421–6426 (2004).
[2] An RNA sensor for intracellular Mg(2+).
Cromie, M. J., Shi, Y., Latifi, T. & Groisman, E. A.
Cell 125, 71–84 (2006).
[3] Structure and mechanism of a metal-sensing regulatory RNA.
Dann, C. E., 3rd et al.
Cell 130, 878–892 (2007).
[4] Multiple metal-binding cores are required for metalloregulation by M-box riboswitch RNAs.
Wakeman, C. A., Ramesh, A. & Winkler, W. C.
J. Mol. Biol. 392, 723–735 (2009).
[5] Insights into metalloregulation by M-box riboswitch RNAs via structural analysis of manganese-bound complexes.
Ramesh, A., Wakeman, C. A. & Winkler, W. C.
J. Mol. Biol. 407, 556–570 (2011).
[6] Bioinformatics and Genomic Analyses of the Suitability of Eight Riboswitches for Antibacterial Drug Targets.
Pavlova, N. & Penchovsky, R.
Antibiotics (Basel) 11, (2022).