Rfam ID: RF00080 (yybP-ykoY manganese riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
The yybP-ykoY leader RNA element was originally discovered in E. coli during a large scale screen and was named SraF. This family was later found to exist upstream of related families of protein genes in many bacteria, including the yybP and ykoY genes in B. subtilis. The specific functions of these proteins are unknown, but this structured RNA element may be involved in their genetic regulation as a riboswitch. The yybP-ykoY element was later proposed to be manganese-responsive after another associated family of genes, YebN/MntP, was shown to encode Mn2+ efflux pumps in several bacteria. Genetic data and a crystal structure confirmed that yybP-ykoY is a manganese riboswitch that directly binds Mn2+ (From Wikipedia).Gene association
Network of genes immediately downstream of the yybP-ykoY riboswitch are predicted to have roles in protecting against metal toxicity. P-ZnR denotes proteins with a peptidase-associated zinc-ribbon and MetJ-Arc denotes proteins with MetJ-Arc DNA-binding domains[2].
|
|
Gene regulation
Potential mechanism of transcriptional regulation by the yybP-ykoY manganese riboswitch in Lactococcus lactis. RNA polymerase produced predominantly terminated transcripts in the absence of Mn2+. Addition of 0.5 millimolar (mM) Mn2+, but not other metals tested (Fe2+, Co2+, Ni2+,and Ca2+), led to highly efficient anti-termination. We present the prototypical mechanism, but not all possible mechanisms[3].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the yybP-ykoY manganese riboswitch. Bottom: Secondary structure depictions of the Lactococcus lactis yybP-ykoY manganese riboswitch according to PDB ID: 4Y1I[3].
5'AAAGGGGAGUAGCGUCGGGAAACCGAAACAAAGUCGUCAAUUCGUGAGGAAACUCACCGGCUUUGUUGACAUACGAAAGUAUGUUUAGCAAGACCUUUCC3' (Sequence from bottom structure )
The overall structure of the Lactococcus lactis yybP-ykoY manganese riboswitch was generated from PDB ID: 4Y1I at 2.85 Å resolution. The structure shows two series of coaxially stacked helices forming an overall hairpin shape, with the highly conserved L1 (yellow) and L3 (orange) docking together and binding two metal ions. Additional available structures that have been solved and detailed information are accessible on Structures page [3].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Lactococcus lactis yybP-ykoY manganese riboswitch generated from PDB ID: 4Y1I at 2.85 Å resolution. The manganese ion is labeled in red. Right: The metal coordination scheme. Mg2+ is coordinated octahedrally by five backbone phosphates and a water. The Mn2+ contains five backbone phosphates and the N7 of A41. N6 of A41 also makes a H-bond to the phosphate of U39[3].
Ligand recognition
The Lactococcus lactis yybP-ykoY riboswitch binds Mn2+ with an effective Kd of ~ 30–40 micromolar (μM), as monitored by both in vitro transcription (IVT) assays and selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE). Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3].
|
|
References
[1] New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control.
Barrick, J. E. et al.
Proc. Natl. Acad. Sci. U. S. A. 101, 6421–6426 (2004).
[2] The ubiquitous yybP-ykoY riboswitch is a manganese-responsive regulatory element.
Dambach, M. et al.
Mol. Cell 57, 1099–1109 (2015).
[3] Mn(2+)-sensing mechanisms of yybP-ykoY orphan riboswitches.
Price, I. R., Gaballa, A., Ding, F., Helmann, J. D. & Ke, A.
Mol. Cell 57, 1110–1123 (2015).
[4] Convergent Use of Heptacoordination for Cation Selectivity by RNA and Protein Metalloregulators.
Bachas, S. T. & Ferré-D’Amaré, A. R.
Cell Chem Biol 25, 962–973.e5 (2018).
[5] A Mn-sensing riboswitch activates expression of a Mn2+/Ca2+ ATPase transporter in Streptococcus.
Martin, J. E. et al.
Nucleic Acids Res. 47, 6885–6899 (2019).
[6] Local-to-global signal transduction at the core of a Mn sensing riboswitch.
Suddala, K. C. et al.
Nat. Commun. 10, 4304 (2019).