Rfam ID: RF03013 (nadA RNA)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2017[1] Discovery of NAD+-I riboswitch by comparative genomics analyses

    Biochemical validation of NAD+-I riboswitch 2019[2]

    2020[3] Crystal structure of the domain 1 of NAD+-I riboswitch

    Crystal structure of the domain 1 and 2 of NAD+-I riboswitch 2020[4]

2023...



Description

NAD+-I riboswitch is the first class of riboswitches that recognize NAD+. It is usually located upstream of nadA genes within the phylum Acidobacteria, which encode quinolinate synthetase, an enzyme that performs a step in NAD+ synthesis. For these reasons it was inferred that the RNAs function as riboswitches.


Gene association

Biosynthetic pathway of NAD+and related molecules in Escherichia coli. All NAD+-I riboswitch representatives are found exclusively upstream of nadA genes[2].

drawing


Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the NAD+-I riboswitch. Bottom: Secondary structure depictions of the Candidatus koribacter versatilis NAD+-I riboswitch according to PDB ID:6TFF[1,3].

5'GGCUUCAACAACCCCGUAGGUUGGGCCGAAAGGCAGCGAAUCUACUGGAGCC3' (Sequence from bottom structure )



3D visualisation

The crystal structure of the domain 1 of the Candidatus koribacter versatilis NAD+-I riboswitch was generated from PDB ID: 6TFF at 2.52 Å resolution. Additional available structures that have been solved and detailed information are accessible on Structures page [3].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

(Left) Surface representation of the binding pocket of the the domain 1 and 2 of the Candidatus koribacter versatilis NAD+-I riboswitch generated from PDB ID:6TFF at 2.52 Å resolution and 6TF1 at 2.52 Å resolution. (Right) The hydrogen bonds of the two binding sites of the NAD+-I riboswitch bound with NAD+[3-4].

drawing drawing


Ligand recognition

Chemical structures of nicotinamide adenine dinucleotide (NAD+) and its analogs. The apparent KD of each compound of NAD+-I riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2].

drawing



References

[1] Detection of 224 candidate structured RNAs by comparative analysis of specific subsets of intergenic regions
Weinberg, Z. et al.
Nucleic Acids Res. 45, 10811–10823 (2017).

[2] Evidence that the nadA motif is a bacterial riboswitch for the ubiquitous enzyme cofactor NAD
Malkowski, S. N., Spencer, T. C. J. & Breaker, R. R.
RNA 25, 1616–1627 (2019).

[3] Structure and ligand binding of the ADP-binding domain of the NAD+ riboswitch
Huang, L., Wang, J. & Lilley, D. M. J.
RNA 26, 878–887 (2020).

[4] Structural distinctions between NAD+ riboswitch domains 1 and 2 determine differential folding and ligand binding
Chen, H. et al.
Nucleic Acids Res. 48, 12394–12406 (2020).