Rfam ID: RF03013 (nadA RNA)
Click the buttons to navigate to different sections:
Timeline
Description
NAD+-I riboswitch is the first class of riboswitches that recognize NAD+. It is usually located upstream of nadA genes within the phylum Acidobacteria, which encode quinolinate synthetase, an enzyme that performs a step in NAD+ synthesis. For these reasons it was inferred that the RNAs function as riboswitches.Gene association
Biosynthetic pathway of NAD+and related molecules in Escherichia coli. All NAD+-I riboswitch representatives are found exclusively upstream of nadA genes[2].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the NAD+-I riboswitch. Bottom: Secondary structure depictions of the Candidatus koribacter versatilis NAD+-I riboswitch according to PDB ID:6TFF[1,3].
5'GGCUUCAACAACCCCGUAGGUUGGGCCGAAAGGCAGCGAAUCUACUGGAGCC3' (Sequence from bottom structure )
The crystal structure of the domain 1 of the Candidatus koribacter versatilis NAD+-I riboswitch was generated from PDB ID: 6TFF at 2.52 Å resolution. Additional available structures that have been solved and detailed information are accessible on Structures page [3].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
(Left) Surface representation of the binding pocket of the the domain 1 and 2 of the Candidatus koribacter versatilis NAD+-I riboswitch generated from PDB ID:6TFF at 2.52 Å resolution and 6TF1 at 2.52 Å resolution. (Right) The hydrogen bonds of the two binding sites of the NAD+-I riboswitch bound with NAD+[3-4].
Ligand recognition
Chemical structures of nicotinamide adenine dinucleotide (NAD+) and its analogs. The apparent KD of each compound of NAD+-I riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2].
|
|
References
[1] Detection of 224 candidate structured RNAs by comparative analysis of specific subsets of intergenic regions
Weinberg, Z. et al.
Nucleic Acids Res. 45, 10811–10823 (2017).
[2] Evidence that the nadA motif is a bacterial riboswitch for the ubiquitous enzyme cofactor NAD
Malkowski, S. N., Spencer, T. C. J. & Breaker, R. R.
RNA 25, 1616–1627 (2019).
[3] Structure and ligand binding of the ADP-binding domain of the NAD+ riboswitch
Huang, L., Wang, J. & Lilley, D. M. J.
RNA 26, 878–887 (2020).
[4] Structural distinctions between NAD+ riboswitch domains 1 and 2 determine differential folding and ligand binding
Chen, H. et al.
Nucleic Acids Res. 48, 12394–12406 (2020).