Rfam ID: RF02683 (NiCo riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
The NiCo riboswitch is a riboswitch that senses nickel or cobalt ions. Thus, it is an RNA molecule that specifically binds these metal ions, and regulates genes accordingly. The riboswitch is thought to be a part of a system that responds to toxic levels of these metal ions, although the riboswitch might also participate in dealing with the situation where insufficient levels of these trace elements are present in the cell. The crystal structure of a NiCo riboswitch has been determined, and available evidence suggests that the riboswitches bind their metal-ion ligands cooperatively (From Wikipedia).Gene association
The predicted metal transporters regulated by czcD riboswitches fall into three classes: P1B4-type ATPases (exporters), P3-type ATPases (importers), and cation diffusion facilitators (CDFs, usually exporters). These riboswitches were identified in Gram-positive, obligate anaerobes primarily from the human gut[4].
|
|
Gene regulation
Potential mechanism of the NiCo riboswitch for controlling gene expression in E. bacterium. The NiCo riboswitch is an “on” transcription-termination riboswitch. In the ligand-unbound form, a terminator stem is formed, which leads to transcription to be aborted by RNA polymerase. Binding of the ligand induces a conformational change in which part of the terminator stem sequence is sequestered, allowing transcription read-through and expression of the downstream gene. We present the prototypical mechanism, but not all possible mechanisms[4].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the NiCo riboswitch. Bottom: Secondary structure depictions of the E. bacterium NiCo riboswitch according to PDB ID: 4RUM. Helices P1-P2 (pink) and P3-P4 (blue) form a 'H'-shaped structure stabilized at the junction by four Co2+ ions. Inner sphere (filled symbols) mediated contacts to different metals are shown in key[2].
5'GGGAACUGAGCAGGCAAUGACCAGAGCGGUCAUGCAGCCGGGCUGCGAAAGCGGCAACAGAUGAUUACACGCACAUCUGUGGGACAGUUCCCAC3' (Sequence from bottom structure )
The overall structure of the E. bacterium NiCo riboswitch was generated from PDB ID: 4RUM at 2.64 Å resolution bound to cobalt. Crystal structure of NiCo shows two sets of coaxially stacked helices: P1-P2 (pink) and P3-P4 (blue). Interhelical nucleotides coordinate four Co2+ ions (red). Anti-terminator nucleotides 78 to 98 (cyan) are sequestered within P4 and P1, making direct contacts with Co2+ ions. Additional available structures that have been solved and detailed information are accessible on Structures page [1].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the E. bacterium NiCo riboswitch generated from PDB ID: 4RUM at 2.64 Å resolution. The Co2+ ions are labeled in red. Right: Co2+ ions (red) bound to NiCo are coordinated by interhelical nucleotides from diametrically opposite sides of the RNA. G87 coordinates cobalt 1 via N7 and cobalt 2 via its ribose oxygen. G45 coordinates cobalt 2 via water mediated contacts with a ribosyl oxygen and cobalt 3 via its N7. These long-range connections extend from A14 to G86 via G45 and G87, connecting three of the Co2+ sites[1].
Ligand recognition
Isothermal titration calorimetry studies of the native czcD riboswitches show no response to MnII, a weak response to ZnII, and similar dissociation constants (∼1μM) and conformational responses for FeII, CoII, and NiII. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[4].
|
|
References
[1] Bacterial riboswitches cooperatively bind Ni(2+) or Co(2+) ions and control expression of heavy metal transporters.
Furukawa, K. et al.
Mol. Cell 57, 1088–1098 (2015).
[2] The (NiCo) Riboswitch Responds to Iron(II).
Xu, J. & Cotruvo, J. A., Jr.
Biochemistry 59, 1508–1516 (2020).
[3] Sequential Folding of the Nickel/Cobalt Riboswitch Is Facilitated by a Conformational Intermediate: Insights from Single-Molecule Kinetics and Thermodynamics.
Sung, H.-L. & Nesbitt, D. J.
J. Phys. Chem. B 124, 7348–7360 (2020).
[4] Iron-responsive riboswitches.
Xu, J. & Cotruvo, J. A., Jr.
Curr. Opin. Chem. Biol. 68, 102135 (2022).
[5] Reconsidering the (NiCo) Riboswitch as an Iron Riboswitch.
Xu, J. & Cotruvo, J. A., Jr.
ACS Bio Med Chem Au 2, 376–385 (2022).