Rfam ID: RF00522 (PreQ1 riboswitch)
RF01054 (preQ1-II (pre queuosine) riboswitch )
RF02680 (PreQ1-III riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
PreQ1 (prequeuosine1) is a guanine-derived nucleobase that is known to be incorporated in the wobble position of tRNAs containing the GUN anticodon sequence and then further modified to yield queuosine (Q). Three subcategories of the PreQ1 riboswitch exist: PreQ1-I, PreQ1-II, and PreQ1-III. PreQ1-I has a distinctly small aptamer, ranging from 25 to 45 nucleotides long, and it is represented by RNAs sub-classified as ‘type 1', ‘type 2' and ‘type 3'. PreQ1-II riboswitch, only found in Lactobacillales, has a larger and more complex consensus sequence and structure than preQ1-I riboswitch, with an average of 58 nucleotides composing its aptamer, which forms as many as five base-paired substructures. PreQ1-III riboswitch has a distinct structure and is also larger in aptamer size than preQ1-I riboswitch, ranging from 33 to 58 nucleotides (from Wikipedia).Gene association
PreQ1-I regulates expression of genes (queC, queD, queE and queF) involved in biosynthesis of the nucleoside queuosine (Q) from GTP in eubacteria. Unlike other preQ1-I riboswitches, PreQ1-I type 3 RNAs were found only in association with yhhQ genes, which are proposed to code for inner membrane proteins of unknown function in Gammaproteobacteria. PreQ1-II was identified upstream of genes classified as COG4708 from the family Streptococcaceae, which are predicted to be a transporter of preQ1. Most sequenced examples of preQ1-III riboswitches are obtained from environmental DNA samples, and known examples of preQ1-III riboswitches are found upstream of queT genes, which are expected to encode transporters of a queuosine derivative[1,2,12].
|
|
Gene regulation
PreQ1-I riboswitches from Bacillus subtilis and Shigella dysenteriae control gene expression respectively through transcription and translation. The Shine-Dalgarno (SD) sequence is shaded in orange. We present the prototypical mechanism, but not all possible mechanisms[1,12].
|
|
|
Mechanisms for regulation of gene expression by PreQ1-II from Streptococcus pneumoniae and PreQ1-III riboswitches from Faecalibacterium prausnitzii. The Shine-Dalgarno sequence (SD) is shaded in orange. We present the prototypical mechanism, but not all possible mechanisms[2,12,14].
|
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the PreQ1-I riboswitch. Bottom: Secondary structure depictions of the Bacillus subtilis PreQ1-I type 2 riboswitch according to PDB ID: 3FU2[1,3,12].
5' AGAGGUUCUAGCUACACCCUCUAUAAAAAACUAA 3' (Sequence from bottom structure )
Top: Consensus sequence and secondary structure model for the Lacticaseibacillus rhamnosus PreQ1-II riboswitch. Bottom: Secondary structure depictions of the PreQ1-II riboswitch according to PDB ID: 4JF2[10,12].
5' GGAACCGCGAAAGCGGUUCCACGACGAUACUUAUUUCCUUUGAUCGUCGUUAUUACUGGCUUCGGCCACAAAGGAGA 3' (Sequence from bottom structure )
Top: Consensus sequence and secondary structure model for the PreQ1-III riboswitch. Bottom: Secondary structure depictions of the Faecalibacterium prausnitzii PreQ1-III riboswitch according to PDB ID: 4RZD[12,14].
5' GAGCAACUUAGGAUUUUAGGCUCCCCGGCGUGUCUCGAACCAUGCCGGGCCAAACCCAUAGGGCUGGCGGUCCCUGUGCGGUCAAAAUUCAUCCGCCGGAG 3' (Sequence from bottom structure )
The overall structure of the Bacillus subtilis PreQ1-I riboswitch was generated from PDB ID: 3FU2 at 2.85 Å resolution bound with PreQ1. PreQ1 (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Bacillus subtilis PreQ1-I riboswitch generated from PDB ID: 3FU2 at 2.85 Å. PreQ1 (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the PreQ1-I riboswitch bound with PreQ1[3].
Left: Surface representation of the binding pocket of the Lacticaseibacillus rhamnosus PreQ1-II riboswitch generated from PDB ID: 4JF2 at 2.28 Å. PreQ1 (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the PreQ1-II riboswitch bound with PreQ1[10].
Left: Surface representation of the binding pocket of the Faecalibacterium prausnitzii PreQ1-III riboswitch generated from PDB ID: 4RZD at 2.75 Å. PreQ1 (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the PreQ1-III riboswitch bound with PreQ1[14].
Ligand recognition
Chemical structures of PreQ1 (prequeuosine1) and its analogs. The apparent KD of each compound of three classes of preQ1 riboswitches is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[1-3,12,14].
|
|
References
[1] A riboswitch selective for the queuosine precursor preQ1 contains an unusually small aptamer domain
Roth, A. et al
Nat. Struct. Mol. Biol. 14, (2007)
[2] Confirmation of a second natural preQ1 aptamer class in Streptococcaceae bacteria
Meyer, M. M., Roth, A., Chervin, S. M., Garcia, G. A. & Breaker, R. R
RNA 14, (2008)
[3] Cocrystal structure of a class I preQ1 riboswitch reveals a pseudoknot recognizing an essential hypermodified nucleobase.
Klein, D. J., Edwards, T. E. & Ferré-D’Amaré, A. R.
Nat. Struct. Mol. Biol. 16, (2009).
[4] Structural Insights into riboswitch control of the biosynthesis of queuosine, a modified nucleotide found in the anticodon of Trna.
Kang, M., Peterson, R. & Feigon, J.
Mol. Cell 33, (2009).
[5] The Structural Basis for Recognition of the PreQ0 Metabolite by an Unusually Small Riboswitch Aptamer Domain.
Spitale, R. C., Torelli, A. T., Krucinska, J., Bandarian, V. & Wedekind, J. E.
J. Biol. Chem. 284, (2009).
[6] Comparison of a PreQ1 Riboswitch Aptamer in Metabolite-bound and Free States with Implications for Gene Regulation.
Jenkins, J. L., Krucinska, J., McCarty, R. M., Bandarian, V. & Wedekind, J. E.
J. Biol. Chem. 286, (2011).
[7] Folding of a transcriptionally acting preQ1 riboswitch.
Rieder, U., Kreutz, C. & Micura, R.
Proc. Natl. Acad. Sci. U. S. A. 107, 10804–10809 (2010).
[8] Pseudoknot preorganization of the preQ1 class I riboswitch.
Santner, T., Rieder, U., Kreutz, C. & Micura, R.
J. Am. Chem. Soc. 134, (2012).
[9] Tuning a riboswitch response through structural extension of a pseudoknot.
Soulière, M. F. et al.
Proc. Natl. Acad. Sci. U. S. A. 110, (2013).
[10] Structure of a class II preQ1 riboswitch reveals ligand recognition by a new fold.
Liberman, J. A., Salim, M., Krucinska, J. & Wedekind, J. E.
Nat. Chem. Biol. 9, (2013).
[11] Structural determinants for ligand capture by a class II preQ1 riboswitch.
Kang, M., Eichhorn, C. D. & Feigon, J.
Proc. Natl. Acad. Sci. U. S. A. 111, (2014).
[12] Structural, Functional, and Taxonomic Diversity of Three PreQ1 Riboswitch Classes.
McCown, P. J., Liang, J. J., Weinberg, Z. & Breaker, R. R.
Chem. Biol. 21, (2014).
[13] Mg(2+) shifts ligand-mediated folding of a riboswitch from induced-fit to conformational selection.
Suddala, K. C., Wang, J., Hou, Q. & Walter, N. G.
J. Am. Chem. Soc. 137, 14075–14083 (2015).
[14] Structural analysis of a class III preQ1 riboswitch reveals an aptamer distant from a ribosome-binding site regulated by fast dynamics.
Liberman, J. A.
Proc. Natl. Acad. Sci. U. S. A. 112, (2015).
[15] Ligand Modulates Cross-Coupling between Riboswitch Folding and Transcriptional Pausing.
Widom, J. R. et al.
Mol. Cell 72, (2018).
[16] Synthetic ligands for PreQ1 riboswitches provide structural and mechanistic insights into targeting RNA tertiary structure.
Connelly, C. M. et al.
Nat. Commun. 10, (2019).
[17] Observation of preQ1-II riboswitch dynamics using single-molecule FRET.
Warnasooriya, C. et al.
RNA Biol. 16, 1086–1092 (2019).
[18] Analysis of a preQ1-I riboswitch in effector-free and bound states reveals a metabolite-programmed nucleobase-stacking spine that controls gene regulation.
Schroeder, G. M. et al.
Nucleic Acids Res. 48, (2020).
[19] Microsecond Folding of preQ1 Riboswitch and Its Biological Significance Revealed by Two-Dimensional Fluorescence Lifetime Correlation Spectroscopy.
Sarkar, B., Ishii, K. & Tahara, T.
J. Am. Chem. Soc. 143, 7968–7978 (2021).
[20] A natural riboswitch scaffold with self-methylation activity.
Flemmich, L., Heel, S., Moreno, S., Breuker, K. & Micura, R.
Nat. Commun. 12, (2021).
[21] A small RNA that cooperatively senses two stacked metabolites in one pocket for gene control.
Schroeder, G. M. et al.
Nat. Commun. 13, (2022).