Rfam ID: RF00522 (PreQ1 riboswitch)

    RF01054 (preQ1-II (pre queuosine) riboswitch )

    RF02680 (PreQ1-III riboswitch)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2007[1] Discovery of preQ1-I riboswitch

    Discovery of preQ1-II riboswitch 2008[2]

    2009[3] Crystal structures of the preQ1-I type 2 riboswitch bound to preQ1

    NMR solution studies of preQ1-I type 2 riboswitch bound to preQ12009[4]

    2009[5] Crystal structures of the preQ1-I type 1 riboswitch bound to preQ0

    Crystal structures of the preQ1 type 2 riboswitch in the preQ1-bound and free states 2011[6]

    2010[7] The ligand-induced response mechanism of PreQ1-I riboswitch that modulates gene expression at the molecular and biophysical level

    NMR spectroscopy reveals that preQ1-I riboswitch preorganizes into a pseudoknot fold in a temperature- and Mg2+-dependent manner 2012[8]

    2013[9] The unique 3′-stem–loop element in the preQ1-II riboswitch contributes to the process of SD sequestration, and thus the regulation of gene expression

    Crystal structures of the preQ1-II riboswitch bound to preQ12013[10]

    2014[11] NMR solution studies of preQ1-II riboswitch bound to preQ1

    Discovery of preQ1-I type3 riboswitch and preQ1-III riboswitch 2014[12]

    2015[13] The smFRET study showing that the riboswitch adopts different molecular recognition mechanisms for ligand recognition in different magnesium ion concentrations

    Crystal structures of the preQ1-III riboswitch bound to preQ12015[14]

    2018[15] Ligand modulates cross-coupling between co-transcriptional folding of the pseudoknot-structured preQ1 riboswitch and RNA polymerase (RNAP) pausing

    A smFRET and TIRF study demonstrating the stabilizing effect of Mg2+ ions and preQ1 upon preQ1-II riboswitch conformations that sequester the SD sequence within the core structure. 2019[17]

    2020[18] long-range stacking spine in preQ1-I type 2 riboswitche that links effector binding to the expression platform

    The 2D FLCS study indicating that the aptamer domain of preQ1-I undergoes folding/unfolding including three forms, which are attributed to hairpin (O), pseudoknot-like (pF), and H-type pseudoknot (fF) structures. 2021[19]

    2021[20] The self-methylation activity of natural preQ1-I type 1 riboswitch with O6-methyl pre-queuosine (m6preQ1) as methyl donor

    Crystal structures of preQ1-I riboswitch bound to two preQ1 ligands in a single binding pocket 2022[21]

2023...



Description

PreQ1 (prequeuosine1) is a guanine-derived nucleobase that is known to be incorporated in the wobble position of tRNAs containing the GUN anticodon sequence and then further modified to yield queuosine (Q). Three subcategories of the PreQ1 riboswitch exist: PreQ1-I, PreQ1-II, and PreQ1-III. PreQ1-I has a distinctly small aptamer, ranging from 25 to 45 nucleotides long, and it is represented by RNAs sub-classified as ‘type 1', ‘type 2' and ‘type 3'. PreQ1-II riboswitch, only found in Lactobacillales, has a larger and more complex consensus sequence and structure than preQ1-I riboswitch, with an average of 58 nucleotides composing its aptamer, which forms as many as five base-paired substructures. PreQ1-III riboswitch has a distinct structure and is also larger in aptamer size than preQ1-I riboswitch, ranging from 33 to 58 nucleotides (from Wikipedia).


Gene association

PreQ1-I regulates expression of genes (queC, queD, queE and queF) involved in biosynthesis of the nucleoside queuosine (Q) from GTP in eubacteria. Unlike other preQ1-I riboswitches, PreQ1-I type 3 RNAs were found only in association with yhhQ genes, which are proposed to code for inner membrane proteins of unknown function in Gammaproteobacteria. PreQ1-II was identified upstream of genes classified as COG4708 from the family Streptococcaceae, which are predicted to be a transporter of preQ1. Most sequenced examples of preQ1-III riboswitches are obtained from environmental DNA samples, and known examples of preQ1-III riboswitches are found upstream of queT genes, which are expected to encode transporters of a queuosine derivative[1,2,12].

drawing


Gene regulation

PreQ1-I riboswitches from Bacillus subtilis and Shigella dysenteriae control gene expression respectively through transcription and translation. The Shine-Dalgarno (SD) sequence is shaded in orange. We present the prototypical mechanism, but not all possible mechanisms[1,12].

drawing drawing



Mechanisms for regulation of gene expression by PreQ1-II from Streptococcus pneumoniae and PreQ1-III riboswitches from Faecalibacterium prausnitzii. The Shine-Dalgarno sequence (SD) is shaded in orange. We present the prototypical mechanism, but not all possible mechanisms[2,12,14].

drawing drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the PreQ1-I riboswitch. Bottom: Secondary structure depictions of the Bacillus subtilis PreQ1-I type 2 riboswitch according to PDB ID: 3FU2[1,3,12].

5' AGAGGUUCUAGCUACACCCUCUAUAAAAAACUAA 3' (Sequence from bottom structure )



Top: Consensus sequence and secondary structure model for the Lacticaseibacillus rhamnosus PreQ1-II riboswitch. Bottom: Secondary structure depictions of the PreQ1-II riboswitch according to PDB ID: 4JF2[10,12].

5' GGAACCGCGAAAGCGGUUCCACGACGAUACUUAUUUCCUUUGAUCGUCGUUAUUACUGGCUUCGGCCACAAAGGAGA 3' (Sequence from bottom structure )



Top: Consensus sequence and secondary structure model for the PreQ1-III riboswitch. Bottom: Secondary structure depictions of the Faecalibacterium prausnitzii PreQ1-III riboswitch according to PDB ID: 4RZD[12,14].

5' GAGCAACUUAGGAUUUUAGGCUCCCCGGCGUGUCUCGAACCAUGCCGGGCCAAACCCAUAGGGCUGGCGGUCCCUGUGCGGUCAAAAUUCAUCCGCCGGAG 3' (Sequence from bottom structure )



3D visualisation

The overall structure of the Bacillus subtilis PreQ1-I riboswitch was generated from PDB ID: 3FU2 at 2.85 Å resolution bound with PreQ1. PreQ1 (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






The overall structure of the Lacticaseibacillus rhamnosus PreQ1-II riboswitch was generated from PDB ID: 4JF2 at 2.28 Å resolution bound with PreQ1. PreQ1 (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [10].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






The overall structure of the Faecalibacterium prausnitzii PreQ1-III riboswitch was generated from PDB ID: 4RZD at 2.75 Å resolution bound with PreQ1. PreQ1 (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [14].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Bacillus subtilis PreQ1-I riboswitch generated from PDB ID: 3FU2 at 2.85 Å. PreQ1 (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the PreQ1-I riboswitch bound with PreQ1[3].

drawing drawing


Left: Surface representation of the binding pocket of the Lacticaseibacillus rhamnosus PreQ1-II riboswitch generated from PDB ID: 4JF2 at 2.28 Å. PreQ1 (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the PreQ1-II riboswitch bound with PreQ1[10].

drawing drawing


Left: Surface representation of the binding pocket of the Faecalibacterium prausnitzii PreQ1-III riboswitch generated from PDB ID: 4RZD at 2.75 Å. PreQ1 (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding sites of the PreQ1-III riboswitch bound with PreQ1[14].

drawing drawing


Ligand recognition

Chemical structures of PreQ1 (prequeuosine1) and its analogs. The apparent KD of each compound of three classes of preQ1 riboswitches is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[1-3,12,14].

drawing



References

[1] A riboswitch selective for the queuosine precursor preQ1 contains an unusually small aptamer domain
Roth, A. et al
Nat. Struct. Mol. Biol. 14, (2007)

[2] Confirmation of a second natural preQ1 aptamer class in Streptococcaceae bacteria
Meyer, M. M., Roth, A., Chervin, S. M., Garcia, G. A. & Breaker, R. R
RNA 14, (2008)

[3] Cocrystal structure of a class I preQ1 riboswitch reveals a pseudoknot recognizing an essential hypermodified nucleobase.
Klein, D. J., Edwards, T. E. & Ferré-D’Amaré, A. R.
Nat. Struct. Mol. Biol. 16, (2009).

[4] Structural Insights into riboswitch control of the biosynthesis of queuosine, a modified nucleotide found in the anticodon of Trna.
Kang, M., Peterson, R. & Feigon, J.
Mol. Cell 33, (2009).

[5] The Structural Basis for Recognition of the PreQ0 Metabolite by an Unusually Small Riboswitch Aptamer Domain.
Spitale, R. C., Torelli, A. T., Krucinska, J., Bandarian, V. & Wedekind, J. E.
J. Biol. Chem. 284, (2009).

[6] Comparison of a PreQ1 Riboswitch Aptamer in Metabolite-bound and Free States with Implications for Gene Regulation.
Jenkins, J. L., Krucinska, J., McCarty, R. M., Bandarian, V. & Wedekind, J. E.
J. Biol. Chem. 286, (2011).

[7] Folding of a transcriptionally acting preQ1 riboswitch.
Rieder, U., Kreutz, C. & Micura, R.
Proc. Natl. Acad. Sci. U. S. A. 107, 10804–10809 (2010).

[8] Pseudoknot preorganization of the preQ1 class I riboswitch.
Santner, T., Rieder, U., Kreutz, C. & Micura, R.
J. Am. Chem. Soc. 134, (2012).

[9] Tuning a riboswitch response through structural extension of a pseudoknot.
Soulière, M. F. et al.
Proc. Natl. Acad. Sci. U. S. A. 110, (2013).

[10] Structure of a class II preQ1 riboswitch reveals ligand recognition by a new fold.
Liberman, J. A., Salim, M., Krucinska, J. & Wedekind, J. E.
Nat. Chem. Biol. 9, (2013).

[11] Structural determinants for ligand capture by a class II preQ1 riboswitch.
Kang, M., Eichhorn, C. D. & Feigon, J.
Proc. Natl. Acad. Sci. U. S. A. 111, (2014).

[12] Structural, Functional, and Taxonomic Diversity of Three PreQ1 Riboswitch Classes.
McCown, P. J., Liang, J. J., Weinberg, Z. & Breaker, R. R.
Chem. Biol. 21, (2014).

[13] Mg(2+) shifts ligand-mediated folding of a riboswitch from induced-fit to conformational selection.
Suddala, K. C., Wang, J., Hou, Q. & Walter, N. G.
J. Am. Chem. Soc. 137, 14075–14083 (2015).

[14] Structural analysis of a class III preQ1 riboswitch reveals an aptamer distant from a ribosome-binding site regulated by fast dynamics.
Liberman, J. A.
Proc. Natl. Acad. Sci. U. S. A. 112, (2015).

[15] Ligand Modulates Cross-Coupling between Riboswitch Folding and Transcriptional Pausing.
Widom, J. R. et al.
Mol. Cell 72, (2018).

[16] Synthetic ligands for PreQ1 riboswitches provide structural and mechanistic insights into targeting RNA tertiary structure.
Connelly, C. M. et al.
Nat. Commun. 10, (2019).

[17] Observation of preQ1-II riboswitch dynamics using single-molecule FRET.
Warnasooriya, C. et al.
RNA Biol. 16, 1086–1092 (2019).

[18] Analysis of a preQ1-I riboswitch in effector-free and bound states reveals a metabolite-programmed nucleobase-stacking spine that controls gene regulation.
Schroeder, G. M. et al.
Nucleic Acids Res. 48, (2020).

[19] Microsecond Folding of preQ1 Riboswitch and Its Biological Significance Revealed by Two-Dimensional Fluorescence Lifetime Correlation Spectroscopy.
Sarkar, B., Ishii, K. & Tahara, T.
J. Am. Chem. Soc. 143, 7968–7978 (2021).

[20] A natural riboswitch scaffold with self-methylation activity.
Flemmich, L., Heel, S., Moreno, S., Breuker, K. & Micura, R.
Nat. Commun. 12, (2021).

[21] A small RNA that cooperatively senses two stacked metabolites in one pocket for gene control.
Schroeder, G. M. et al.
Nat. Commun. 13, (2022).