Rfam ID: RF01057 (S-adenosyl-L-homocysteine riboswitch)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2008[1] Discovery of SAH riboswitch

    Compare the features of SAM and SAH riboswitches 2008[2]

    2010[3] Crystal structure of SAH riboswitch

    SAH riboswitch has been shown to be capable of regulating gene expression in human cells 2010[4]

    2023[5] This review summarizes the current research progress on these SAM-related riboswitch families

2023...



Description

SAH riboswitches are a kind of riboswitch that bind S-adenosylhomocysteine (SAH). When the coenzyme S-adenosylmethionine (SAM) is used in a methylation reaction, SAH is produced. SAH riboswitches typically up-regulate genes involved in recycling SAH to create more SAM (or the metabolically related methionine). This is particularly relevant to cells, because high levels of SAH can be toxic. Originally identified by bioinformatics, SAH riboswitches are apparent in many species of bacteria, predominantly certain Pseudomonadota and Actinomycetota. The atomic-resolution 3-dimensional structure of an SAH riboswitch has been solved using X-ray crystallography (from WiKi).


Gene association

Pathways for sulphate assimilation and biosynthesis of cysteine and methionine of Escherichia coli or Pseudomonas syringae. SAH riboswitch (red bar) is involved in multiple gene regulation in the synthetic pathway[1].

drawing


Gene regulation

Model of SAH riboswitch sequential folding and translational control in Pseudomonas syringae. We present the prototypical mechanism, but not all possible mechanisms[1].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the SAH riboswitch. Bottom: Secondary structure depictions of the plant pathogen Ralstonia solanacearum SAH riboswitch according to PDB ID: 3NPQ.

5'GGACGAGGAGCGCUGCAAGCGAGAGCCCAGGCUCGUCCGUUCAAACGGCGCUCA3' (Sequence from bottom structure )



3D visualisation

2.18-Å resolution crystal structure of an SAH riboswitch from Ralstonia solanacearum complexed with S-adenosylmethionine. The figure reference from PDB ID: 3NPQ, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Ralstonia solanacearum SAH riboswitch generated from PDB ID: 3NPQ at 2.18-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases[3].

drawing drawing


Ligand recognition

Chemical structures of various compounds used to probe the binding characteristics of the SAH riboswitch. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3].

drawing



References

[1] Riboswitches that sense S-adenosylhomocysteine and activate genes involved in coenzyme recycling.
Wang, J. X., Lee, E. R., Morales, D. R., Lim, J., & Breaker, R. R.
Mol. Cell 29, 691–702 (2008).

[2] Riboswitches that sense S-adenosylmethionine and S-adenosylhomocysteine.
Wang, J. X., & Breaker, R. R.
Biochem. Cell Biol. 86, 157–168 (2008).

[3] Structural basis for recognition of S-adenosylhomocysteine by riboswitches.
Edwards, A. L., Reyes, F. E., Héroux, A., & Batey, R. T.
RNA 16, 2144–2155 (2010).

[4] Stimulation of -1 programmed ribosomal frameshifting by a metabolite-responsive RNA pseudoknot.
Chou, M. Y., Lin, S. C., & Chang, K. Y.
RNA 16, 1236–1244 (2010).

[5] Structure-based insights into recognition and regulation of SAM-sensing riboswitches.
Zheng L, Song Q, Xu X, Shen X, Li C, Li H, Chen H, Ren A.
Sci China Life Sci.66(1):31-50 (2023).