Rfam ID: RF01767 (SMK box translational riboswitch (SAM-III))
Click the buttons to navigate to different sections:
Timeline
Description
The SMKbox riboswitch (also known as SAM-III) is an RNA element that regulates gene expression in bacteria. The SMK box riboswitch is found in the 5' UTR of the MetK gene in lactic acid bacteria. The structure of this element changes upon binding to S-adenosyl methionine (SAM) to a conformation that blocks the shine-dalgarno sequence and blocks translation of the gene. There are other known SAM-binding riboswitches such as SAM-I and SAM-II, but these appear to share no similarity in sequence or structure to SAM-III (from WiKi).Gene association
Pathways for sulphate assimilation and biosynthesis of cysteine and methionine of Enterococcus faecalis. SAM-III riboswitch (red bar) is involved in multiple gene regulation in the synthetic pathway[1].
|
|
Gene regulation
Translation mechanism of the Enterococcus faecalis SMK box/SAM-III riboswitch, the AUG start codon of metK is indicated in yellow, SD sequence (green) is accessible for translation initiation. We present the prototypical mechanism, but not all possible mechanisms[5].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the SAM-III riboswitch. Bottom: Secondary structure depictions of the Enterococcus faecalis SAM-III riboswitch according to PDB ID: 3E5C.
5'GUUCCCGAAAGGAUGGCGGAAACGCCAGAUGCCUUGUAACCGAAAGGGGGAAU3' (Sequence from bottom structure )
2.25-Å resolution crystal structure of an SAM-III riboswitch from Enterococcus faecalis complexed with S-adenosylmethionine. The figure reference from PDB ID: 3E5C, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Enterococcus faecalis SAM-III riboswitch generated from PDB ID: 3E5C at 2.25-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases[3].
Ligand recognition
Chemical structures of various compounds used to probe the binding characteristics of the SAM-III riboswitch. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[6].
|
|
References
[1] The S(MK) box is a new SAM-binding RNA for translational regulation of SAM synthetase.
Fuchs, R. T., Grundy, F. J., & Henkin, T. M.
Nat. Struct. Mol. Biol. 13, 226–233 (2006).
[2] S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the S(MK) box translational riboswitch RNA.
Fuchs, R. T., Grundy, F. J., & Henkin, T. M.
Proc. Natl. Acad. Sci. U. S. A. 104, 4876–4880 (2007).
[3] Crystal structures of the SAM-III/S(MK) riboswitch reveal the SAM-dependent translation inhibition mechanism.
Lu, C., Smith, A. M., Fuchs, R. T., Ding, F., Rajashankar, K., Henkin, T. M., & Ke, A.
Nat. Struct. Mol. Biol. 15, 1076–1083 (2008).
[4] Atomistic details of the ligand discrimination mechanism of S(MK)/SAM-III riboswitch.
Priyakumar U. D.
J. Phys. Chem. B 114, 9920–9925 (2010).
[5] The SAM-responsive S(MK) box is a reversible riboswitch.
Smith, A. M., Fuchs, R. T., Grundy, F. J., & Henkin, T. M.
Mol. Microbiol. 78, 1393–1402 (2010).
[6] Variable sequences outside the SAM-binding core critically influence the conformational dynamics of the SAM-III/SMK box riboswitch.
Lu, C., Smith, A. M., Ding, F., Chowdhury, A., Henkin, T. M., & Ke, A.
J. Mol. Biol. 409, 786–799 (2011).
[7] Common themes and differences in SAM recognition among SAM riboswitches.
Price IR, Grigg JC, Ke A.
Biochim Biophys Acta.1839(10):931-938.(2014)
[8] Ligand-induced stabilization of a duplex-like architecture is crucial for the switching mechanism of the SAM-III riboswitch.
Suresh, G., Srinivasan, H., Nanda, S., & Priyakumar, U. D.
Biochemistry 55, 3349–3360 (2016).
[9] Reversible-switch mechanism of the SAM-III riboswitch.
Gong, S., Wang, Y., Wang, Z., Wang, Y., & Zhang, W.
J. Phys. Chem. B 120, 12305–12311 (2016).
[10] Decoding the identification mechanism of an SAM-III riboswitch on ligands through multiple independent gaussian-accelerated molecular dynamics simulations.
Chen, J., Zeng, Q., Wang, W., Sun, H., & Hu, G.
J. Chem. Inf. Model. 62, 6118–6132 (2022).
[11] Structure-based insights into recognition and regulation of SAM-sensing riboswitches.
Zheng L, Song Q, Xu X, Shen X, Li C, Li H, Chen H, Ren A.
Sci China Life Sci.66(1):31-50 (2023).