Rfam ID: RF00521 (SAM riboswitch (alpha-proteobacteria))

    RF01826 (SAM-V riboswitch)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2005[1] Discovery of SAM-II riboswitch

    Crystal structure of the SAM-II riboswitch 2008[3]

    2009[4] Discovery of SAM-V riboswitch

    The consensus sequence and structure of SAM-V show some similarities to that of the SAM-II riboswitch 2009[5]

    2011[6] Explored the ligand-induced folding process of the S-adenosylmethionine type II(SAM-II) riboswitch using NMR and fluorescence spectroscopy, and single-molecule fluorescence imaging

    Discussing a recent smFRET study on the SAM-II riboswitch 2011[7]

    2012[8] The conformational state of the structure is explained

    Metabolite recognition and specificity of the SAM-II riboswitch 2012[9]

    2015[11] Study on the folding mechanism of proteobacteria SAM-II riboswitch by molecular dynamics

    SAM-II riboswitch samples at least two conformations in solution 2016[12]

    2017[13] Effect of magnesium ion on preorganized SAM-II riboswitch

    Solved the X-ray structure of SAM-V riboswitch 2018[14]

    2023[15] This review summarizes the current research progress on these SAM-related riboswitch families

2023...



Description

The SAM-II riboswitch is a RNA element found predominantly in Alphaproteobacteria that binds S-adenosyl methionine (SAM). Its structure and sequence appear to be unrelated to the SAM riboswitch found in Gram-positive bacteria. This SAM riboswitch is located upstream of the metA and metC genes in Agrobacterium tumefaciens, and other methionine and SAM biosynthesis genes in other alpha-proteobacteria. Like the other SAM riboswitch, it probably functions to turn off expression of these genes in response to elevated SAM levels. A significant variant of SAM-II riboswitches was found in Pelagibacter ubique and related marine bacteria and called SAM-V. Also, like many structured RNAs, SAM-II riboswitches can tolerate long loops between their stems. SAM-V riboswitch is the fifth known riboswitch to bind S-adenosyl methionine (SAM). It was first discovered in the marine bacterium Candidatus Pelagibacter ubique and can also be found in marine metagenomes. SAM-V features a similar consensus sequence and secondary structure as the binding site of SAM-II riboswitch, but bioinformatics scans cluster the two aptamers independently. These similar binding pockets suggest that the two riboswitches have undergone convergent evolution (from WiKi).


Gene association

Pathways for sulphate assimilation and biosynthesis of cysteine and methionine of Agrobacterium tumefaciens and Candidatus Pelagibacter ubique. SAM-II riboswitch (red bar) and SAM-V riboswitch (yellow bar) are involved in multiple gene regulation in the synthetic pathway[1,5].

drawing


Gene regulation

Potential mechanism of translation regulation by the SAM-II riboswitch in the Sargasso Sea metagenome metX. We present the prototypical mechanism, but not all possible mechanisms9.

drawing



Potential mechanism of translation regulation by the SAM-V riboswitch in Candidatus Pelagibacter ubique. We present the prototypical mechanism, but not all possible mechanisms14.

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the SAM-II riboswitch. Bottom: Secondary structure depictions of the Sargasso Sea metagenome metX SAM-II riboswitch according to PDB ID: 2QWY.

5'GCGCGGCGAUUUAACCGUAUUGCAGUCGCGUGAUAAAUGUAGCUAAAAAGGA3' (Sequence from bottom structure )



Top: Consensus sequence and secondary structure model for the SAM-V riboswitch. Bottom: Secondary structure depictions of the Candidatus Pelagibacter ubique SAM-V riboswitch according to PDB ID: 6FZ0.

5'AGGCGCAUUUGAACUGUAUUGUACGCCUUGCAUAAAGCAAAAGUACUAAAAAA3' (Sequence from bottom structure )



3D visualisation

2.8-Å resolution crystal structure of an SAM-II riboswitch from the Sargasso Sea metagenome metX complexed with S-adenosylmethionine. The figure reference from PDB ID: 2QWY, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page 3.

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






2.50-Å resolution crystal structure of an SAM-V riboswitch from Candidatus Pelagibacter ubique complexed with S-adenosylmethionine. The figure reference from PDB ID: 6FZ0, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page 14.

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Sargasso Sea metagenome metX SAM-II riboswitch generated from PDB ID: 2QWY at 2.8-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases3.

drawing drawing


Left: Surface representation of the binding pocket of the Candidatus Pelagibacter ubique SAM-V riboswitch generated from PDB ID: 6FZ0 at 2.50-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases14.

drawing drawing


Ligand recognition

Chemical structures of various compounds used to probe the binding characteristics of the SAM-II riboswitch and SAM-V riboswitch. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3,5].

drawing



References

[1] Evidence for a second class of S-adenosylmethionine riboswitches and other regulatory RNA motifs in alpha-proteobacteria.
Corbino, K. A., Barrick, J. E., Lim, J., Welz, R., Tucker, B. J., Puskarz, I., Mandal, M., Rudnick, N. D., & Breaker, R. R.
Genome Biol. 6, R70 (2005).

[2] Molecular-recognition characteristics of SAM-binding riboswitches.
Lim, J., Winkler, W. C., Nakamura, S., Scott, V., & Breaker, R. R.
Angew. Chem. Int. Ed Engl. 45, 964–968 (2006).

[3] Structure of the SAM-II riboswitch bound to S-adenosylmethionine.
Gilbert, S. D., Rambo, R. P., Van Tyne, D., & Batey, R. T.
Nat. Struct. Mol. Biol. 15, 177–182 (2008).

[4] Identification of candidate structured RNAs in the marine organism 'Candidatus Pelagibacter Ubique'.
Meyer, M. M., Ames, T. D., Smith, D. P., Weinberg, Z., Schwalbach, M. S., Giovannoni, S. J., & Breaker, R. R.
BMC Genomics 10, 268 (2009).

[5] A variant riboswitch aptamer class for S-adenosylmethionine common in marine bacteria.
Poiata, E., Meyer, M. M., Ames, T. D., & Breaker, R. R.
RNA 15, 2046–2056 (2009).

[6] Conformational capture of the SAM-II riboswitch.
Haller, A., Rieder, U., Aigner, M., Blanchard, S. C., & Micura, R.
Nat. Chem. Biol. 7, 393–400 (2011).

[7] The dynamic nature of RNA as key to understanding riboswitch mechanisms.
Haller A, Soulière MF, Micura R.
Acc Chem Res.44(12):1339-1348(2011).

[8] Multiple conformations of SAM-II riboswitch detected with SAXS and NMR spectroscopy.
Chen, B., Zuo, X., Wang, Y. X., & Dayie, T. K.
Nucleic Acids Res. 40, 3117–3130 (2012).

[9] Atomic-level insights into metabolite recognition and specificity of the SAM-II riboswitch.
Doshi, U., Kelley, J. M., & Hamelberg, D.
RNA 18, 300–307 (2012).

[10] Common themes and differences in SAM recognition among SAM riboswitches.
Price IR, Grigg JC, Ke A.
Biochim Biophys Acta.1839(10):931-938.(2014)

[11] Folding of SAM-II riboswitch explored by replica-exchange molecular dynamics simulation.
Xue, X., Yongjun, W., & Zhihong, L.
J. Theor. Biol. 365, 265–269 (2015).

[12] SAM-II riboswitch samples at least two conformations in solution in the absence of ligand: implications for recognition.
Chen, B., LeBlanc, R., & Dayie, T. K.
Angew. Chem. Int. Ed Engl. 55, 2724–2727 (2016).

[13] A magnesium-induced triplex pre-organizes the SAM-II riboswitch.
Roy, S., Lammert, H., Hayes, R. L., Chen, B., LeBlanc, R., Dayie, T. K., Onuchic, J. N., & Sanbonmatsu, K. Y.
PLoS Comput. Biol. 13, e1005406 (2017).

[14] Structure and ligand binding of the SAM-V riboswitch.
Huang, L., & Lilley, D. M. J.
Nucleic Acids Res. 46, 6869–6879 (2018).

[15] Structure-based insights into recognition and regulation of SAM-sensing riboswitches.
Zheng L, Song Q, Xu X, Shen X, Li C, Li H, Chen H, Ren A.
Sci China Life Sci.66(1):31-50 (2023).