Rfam ID: RF00162 (SAM riboswitch (S box leader))
RF00634 (S-adenosyl methionine (SAM) riboswitch)
RF01725 (SAM-I/IV variant riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
This family is a member of clan (CL00012), which contains the following 3 members: SAM-I, SAM-I-IV-variant, SAM-IV The SAM riboswitch (also known as the S-box leader and the SAM-I riboswitch) is found upstream of a number of genes which code for proteins involved in methionine or cysteine biosynthesis in Gram-positive bacteria. Two SAM riboswitches in Bacillus subtilis that were experimentally studied act at the level of transcription termination control. The predicted secondary structure consists of a complex stem-loop region followed by a single stem-loop terminator region. An alternative and mutually exclusive form involves bases in the 3' segment of helix 1 with those in the 5' region of helix 5 to form a structure termed the anti-terminator form. When SAM is unbound, the anti-terminator sequence sequesters the terminator sequence so the terminator is unable to form, allowing the polymerase to read-through the downstream gene. When S-Adenosyl methionine (SAM) is bound to the aptamer, the anti-terminator is sequestered by an anti-anti-terminator; the terminator forms and terminates the transcription. However, many SAM riboswitches are likely to regulate gene expression at the level of translation. SAM-IV riboswitches are a kind of riboswitch that specifically binds S-adenosylmethionine (SAM), a cofactor used in many methylation reactions. Originally identified by bioinformatics, SAM-IV riboswitches are largely confined to the Actinomycetales, an order of Bacteria. Conserved features of SAM-IV riboswitch and experiments imply that they probably share a similar SAM-binding site to another class of SAM-binding riboswitches called SAM-I riboswitches. However, the scaffolds of these two types of riboswitch appear to be quite distinct. The structural relationship between these riboswitch types has been studied (from WiKi).Gene association
Pathways for sulphate assimilation and biosynthesis of cysteine and methionine of Escherichia coli and Streptomyces coelicolor. SAM-I riboswitch (red bar), SAM-IV riboswitch (yellow bar) and SAM-I/IV riboswitch (green bar) are involved in multiple gene regulation in the synthetic pathway[1,7,9].
|
|
Gene regulation
Sequence and structural model for the Bacillus subtilis metI riboswitch in two structural states. Moreover, Loh, Edmund et al discovered the trans mechanism of SAM. Two S-adenosylmethionine (SAM) riboswitches, SreA and SreB, can also function in trans and act as noncoding RNAs in Listeria monocytogenes. More specifically, they show that the S-adenosylmethionine riboswitch SreA binds to the distal side of the Escherichia coli prfA-untranslated RNA, thereby causing decreased expression of PrfA. We present the prototypical mechanism, but not all possible mechanisms[2,8].
|
|
Regulation mechanism of Mycobacterium SAM-IV riboswitch, PK-2 plays a direct role in both ligand binding and regulation. We present the prototypical mechanism, but not all possible mechanisms[16,21].
|
|
Regulation mechanism of SAM-I/IV riboswitch for controlling gene expression in env87 variant from a Pacific Ocean metagenome, PK-3 plays a direct role in both ligand binding and regulation. We present the prototypical mechanism, but not all possible mechanisms[16,21].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the SAM-I riboswitch. Bottom: Secondary structure depictions of the Thermoanaerobacter tengcongensis SAM-I riboswitch according to PDB ID: 2GIS.
5'GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCA3' (Sequence from bottom structure )
Top: Consensus sequence and secondary structure model for the SAM-IV riboswitch. Bottom: Secondary structure depictions of the Mycobacterium SAM-IV riboswitch according to PDB ID: 6UET.
5'GGUCAUGAGUGCCAGCGUCAAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCAGGUUGAGUAGCCGUGACGGCUACGCGGCAAGCGCGGGUC3' (Sequence from bottom structure )
Top: Consensus sequence and secondary structure model for the SAM-I/IV riboswitch. Bottom: Secondary structure depictions of the env87 variant SAM-I/IV riboswitch according to PDB ID: 4OQU.
5'GGAUCACGAGGGGGAGACCCCGGCAACCUGGGACGGACACCCAAGGUGCUCACACCGGAGACGGUGGAUCCGGCCCGAGAGGGCAACGAAGGUCCGA3' (Sequence from bottom structure )
2.9-Å resolution crystal structure of an S-adenosylmethionine (SAM) riboswitch from thermoanaerobacter tengcongensis complexed with S-adenosylmethionine. The figure reference from PDB ID: 2GIS, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page 4.3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the thermoanaerobacter tengcongensis SAM-I riboswitch generated from PDB ID: 2GIS at 2.9-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases4.
Left: Surface representation of the binding pocket of the Mycobacterium SAM-IV riboswitch generated from PDB ID: 6UET at 4.1-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: As the current resolution was not sufficient to determine the conformation of hydrogen bonding21.
Left: Surface representation of the binding pocket of the env87 variant SAM-I/IV riboswitch generated from PDB ID: 4OQU at 3.20-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases, the binding site of this part is similar to SAM-I riboswitch, but the base number is different16.
Ligand recognition
Chemical structures of various compounds used to probe the binding characteristics of the SAM-I riboswitch, SAM-IV riboswitch and SAM-I/IV riboswitch. 5'-AMP: 5'-adenosine monophosphate. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below2.
|
|
References
[1] The S box regulon: a new global transcription termination control system for methionine and cysteine biosynthesis genes in gram-positive bacteria.
Grundy, F. J. & Henkin, T. M.
Mol. Microbiol. 30, 737–749 (1998).
[2] An mRNA structure that controls gene expression by binding S-adenosylmethionine.
Winkler, W. C., Nahvi, A., Sudarsan, N., Barrick, J. E., & Breaker, R. R
Nat. Struct. Biol. 10, 701–707 (2003).
[3] Transcription termination control of the S box system: direct measurement of S-adenosylmethionine by the leader RNA.
McDaniel, B. A., Grundy, F. J., Artsimovitch, I., & Henkin, T. M.
Proc. Natl. Acad. Sci. U. S. A. 100, 3083–3088 (2003).
[4] Structure of the S-adenosylmethionine riboswitch regulatory mRNA element.
Montange, R. K., & Batey, R. T.
Nature 441, 1172–1175 (2006).
[5] Identification of 22 candidate structured RNAs in bacteria using the CMfinder comparative genomics pipeline.
Weinberg, Z., Barrick, J. E., Yao, Z., Roth, A., Kim, J. N., Gore, J., Wang, J. X., Lee, E. R., Block, K. F., Sudarsan, N., Neph, S., Tompa, M., Ruzzo, W. L., & Breaker, R. R.
Nucleic Acids Res. 35, 4809–4819 (2007).
[6] A computational pipeline for high-throughput discovery of cis-regulatory noncoding RNA in prokaryotes.
Yao, Z., Barrick, J., Weinberg, Z., Neph, S., Breaker, R., Tompa, M., and Ruzzo, W.L.
PLoS Comput. Biol. 3, e126 (2007).
[7] The aptamer core of SAM-IV riboswitches mimics the ligand-binding site of SAM-I riboswitches.
Weinberg, Z., Regulski, E. E., Hammond, M. C., Barrick, J. E., Yao, Z., Ruzzo, W. L., & Breaker, R. R.
RNA 14, 822–828 (2008).
[8] A trans-acting riboswitch controls expression of the virulence regulator PrfA in Listeria monocytogenes.
Loh, E., Dussurget, O., Gripenland, J., Vaitkevicius, K., Tiensuu, T., Mandin, P., Repoila, F., Buchrieser, C., Cossart, P., & Johansson, J.
Cell, 139(4), 770–779(2009).
[9] Discrimination between closely related cellular metabolites by the SAM-I riboswitch.
Montange, R. K., Mondragón, E., van Tyne, D., Garst, A. D., Ceres, P., & Batey, R. T.
J. Mol. Biol. 396, 761–772 (2010).
[10] Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes.
Weinberg, Z., Wang, J. X., Bogue, J., Yang, J., Corbino, K., Moy, R. H., & Breaker, R. R.
Genome Biol. 11, R31 (2010).
[11] Free state conformational sampling of the SAM-I riboswitch aptamer domain.
Stoddard, C. D., Montange, R. K., Hennelly, S. P., Rambo, R. P., Sanbonmatsu, K. Y., & Batey, R. T.
Structure 18, 787–797 (2010).
[12] SAM recognition and conformational switching mechanism in the Bacillus subtilis yitJ S box/SAM-I riboswitch.
Lu, C., Ding, F., Chowdhury, A., Pradhan, V., Tomsic, J., Holmes, W. M., Henkin, T. M., & Ke, A.
J. Mol. Biol. 404, 803–818 (2010).
[13] Molecular insights into the ligand-controlled organization of the SAM-I riboswitch.
Heppell, B., Blouin, S., Dussault, A. M., Mulhbacher, J., Ennifar, E., Penedo, J. C., & Lafontaine, D. A.
Nat. Chem. Biol. 7, 384–392 (2011).
[14] Folding of the SAM-I riboswitch: a tale with a twist.
Eschbach, S. H., St-Pierre, P., Penedo, J. C., & Lafontaine, D. A.
RNA Biol. 9, 535–541 (2012).
[15] Basis for ligand discrimination between ON and OFF state riboswitch conformations: the case of the SAM-I riboswitch.
Boyapati, V. K., Huang, W., Spedale, J., & Aboul-Ela, F.
RNA 18, 1230–1243 (2012).
[16] Structural basis for diversity in the SAM clan of riboswitches.
Trausch, J. J., Xu, Z., Edwards, A. L., Reyes, F. E., Ross, P. E., Knight, R., & Batey, R. T.
Proc. Natl. Acad. Sci. U. S. A. 111, 6624–6629 (2014).
[17] Common themes and differences in SAM recognition among SAM riboswitches.
Price IR, Grigg JC, Ke A.
Biochim Biophys Acta.1839(10):931-938.(2014)
[18] Ligand recognition and helical stacking formation are intimately linked in the SAM-I riboswitch regulatory mechanism.
Dussault, A.-M., Dubé, A., Jacques, F., Grondin, J. P., and Lafontaine, D. A.
RNA 23, 1539–1551 (2017).
[19] Single-molecule FRET reveals the energy landscape of the full-length SAM-I riboswitch.
Manz, C., Kobitski, A. Y., Samanta, A., Keller, B. G., Jäschke, A., & Nienhaus, G. U.
Nat. Chem. Biol. 13, 1172–1178 (2017).
[20] The multi-state energy landscape of the SAM-I riboswitch: A single-molecule Förster resonance energy transfer spectroscopy study.
Manz, C., Kobitski, A. Y., Samanta, A., Jäschke, A., & Nienhaus, G. U.
J. Chem. Phys. 148, 123324 (2018).
[21] Cryo-EM structure of a 40 kDa SAM-IV riboswitch RNA at 3.7 Å resolution.
Zhang, K., Li, S., Kappel, K., Pintilie, G., Su, Z., Mou, T. C., Schmid, M. F., Das, R., & Chiu, W.
Nat. Commun. 10, 5511 (2019).
[22] A SAM-I riboswitch with the ability to sense and respond to uncharged initiator tRNA.
Tang, D. J., Du, X., Shi, Q., Zhang, J. L., He, Y. P., Chen, Y. M., Ming, Z., Wang, D., Zhong, W. Y., Liang, Y. W., Liu, J. Y., Huang, J. M., Zhong, Y. S., An, S. Q., Gu, H., & Tang, J. L.
Nat. Commun. 11, 2794 (2020).
[23] Targeting SAM-I riboswitch using antisense oligonucleotide technology for inhibiting the growth of staphylococcus aureus and listeria monocytogenes.
Traykovska, M., & Penchovsky, R.
Antibiotics (Basel) 11, (2022).
[24] Structure-based insights into recognition and regulation of SAM-sensing riboswitches.
Zheng L, Song Q, Xu X, Shen X, Li C, Li H, Chen H, Ren A.
Sci China Life Sci.66(1):31-50 (2023).