Rfam ID: RF01727 (SAM/SAH riboswitch)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2010[1] Discovery of SAM-SAH riboswitch

    The NMR resonance assignment of the SAM/SAH binding riboswitch (env9b) in complex with SAH 2018[3]

    2019[4] NMR structure of the SAM/SAH binding riboswitch

    Crystal structure of the SAM/SAH riboswitch 2020[5]

    2023[6] Mg 2+ plays vital roles in SAM/SAH riboswitch function

    This review summarizes the current research progress on these SAM-related riboswitch families 2023[7]

2023...



Description

The SAM–SAH riboswitch is a conserved RNA structure in certain bacteria that binds S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH) and is therefore presumed to be a riboswitch. SAM–SAH riboswitches do not share any apparent structural resemblance to known riboswitches that bind SAM or SAH. The binding affinities for both compounds are similar, but binding for SAH is at least somewhat stronger. SAM–SAH riboswitches are exclusively found in Rhodobacterales, an order of alphaproteobacteria. They are always found in the apparent 5' untranslated regions of metK genes, which encode the enzyme (Methionine adenosyltransferase) that synthesizes SAM (from WIKi).


Gene association

Pathways for sulphate assimilation and biosynthesis of cysteine and methionine of Roseobacter sp. SK209-2-6. SAM-SAH riboswitch (red bar) is involved in multiple gene regulation in the synthetic pathway[1].

drawing


Gene regulation

Model of SAM-SAH riboswitch sequential folding and translational control in Roseobacter sp. SK209-2-6. We present the prototypical mechanism, but not all possible mechanisms[5].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the SAM-SAH riboswitch. Bottom: Secondary structure depictions of the Roseobacter sp. SK209-2-6 SAM-SAH riboswitch according to PDB ID: 6YMM[5].

5'GGUCACAACGGCUUCCUGGCGUGACC3'. 5'AUUGGAGCA3' (Sequence from bottom structure )



3D visualisation

2.2-Å resolution crystal structure of an SAM-SAH riboswitch from Roseobacter sp. SK209-2-6 complexed with S-adenosylmethionine. The figure reference from PDB ID: 6YMM, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [5].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Roseobacter sp. SK209-2-6 SAM-SAH riboswitch generated from PDB ID: 6YMM at 2.2-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases[5].

drawing drawing


Ligand recognition

Chemical structures of various compounds used to probe the binding characteristics of the SAM-VI riboswitch. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[5].

drawing



References

[1] Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes.
Weinberg, Z., Wang, J. X., Bogue, J., Yang, J., Corbino, K., Moy, R. H., & Breaker, R. R.
Genome Biol. 11, R31 (2010).

[2] Detection of 224 candidate structured RNAs by comparative analysis of specific subsets of intergenic regions.
Weinberg, Z., Lünse, C. E., Corbino, K. A., Ames, T. D., Nelson, J. W., Roth, A., Perkins, K. R., Sherlock, M. E., & Breaker, R. R.
Nucleic Acids Res. 45, 10811–10823 (2017).

[3] NMR resonance assignments for the SAM/SAH-binding riboswitch RNA bound to S-adenosylhomocysteine.
Weickhmann, A. K., Keller, H., Duchardt-Ferner, E., Strebitzer, E., Juen, M. A., Kremser, J., Wurm, J. P., Kreutz, C., & Wöhnert, J.
Biomol. NMR Assign. 12, 329–334 (2018).

[4] The structure of the SAM/SAH-binding riboswitch.
Weickhmann, A. K., Keller, H., Wurm, J. P., Strebitzer, E., Juen, M. A., Kremser, J., Weinberg, Z., Kreutz, C., Duchardt-Ferner, E., & Wöhnert, J.
Nucleic Acids Res. 47, 2654–2665 (2019).

[5] Crystal structure and ligand-induced folding of the SAM/SAH riboswitch.
Huang, L., Liao, T. W., Wang, J., Ha, T., & Lilley, D. M. J.
Nucleic Acids Res. 48, 7545–7556 (2020).

[6] Magnesium ions mediate ligand binding and conformational transition of the SAM/SAH riboswitch.
Hu, G., & Zhou, H. X.
BioRxiv : the preprint server for biology, 2023.03.12.532287(2023).

[7] Structure-based insights into recognition and regulation of SAM-sensing riboswitches.
Zheng L, Song Q, Xu X, Shen X, Li C, Li H, Chen H, Ren A.
Sci China Life Sci.66(1):31-50 (2023).