Rfam ID: RF02885 (SAM-VI riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
SAM-VI is a member of the riboswitch family. It is predominantly found in Bifidobacterium and exhibits some similarities to the SAM-III (Smk box) riboswitch class, but lacks most of the highly conserved nucleotides of SAM-III class. SAM-VI aptamers bind the cofactor S-adenosylmethinine SAM (a key metabolite in sulphur metabolism) and discriminate strongly against S-adenosylhomocysteine SAH. The class was discovered by further analysis of Bifido-meK motif RNAs (from WiKi).Gene association
Pathways for sulphate assimilation and biosynthesis of cysteine and methionine of Bifidobacterium. SAM-VI riboswitch (red bar) is involved in multiple gene regulation in the synthetic pathway[1].
|
|
Gene regulation
Model of SAM-VI riboswitch sequential folding and translational control in Bifidobacterium angulatum. We present the prototypical mechanism, but not all possible mechanisms[2].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the SAM-VI riboswitch. Bottom: Secondary structure depictions of the Bifidobacterium angulatum SAM-VI riboswitch according to PDB ID: 6LAS.
5'GGCAUUGUGCCUCGCAUUGCACUCCGCGGGGCGAUAAGUCCUGAAAAGGGAUGUC3' (Sequence from bottom structure )
2.71-Å resolution crystal structure of an SAM-VI riboswitch from Bifidobacterium angulatum complexed with S-adenosylmethionine. The figure reference from PDB ID: 6LAS, SAM (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [2].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Bifidobacterium angulatum SAM-VI riboswitch generated from PDB ID: 6LAS at 2.71-Å resolution. S-adenosylmethionine (SAM) (shown in sticks) is labeled in red. Right: Hydrogen bonding between SAM and adjacent bases[2].
Ligand recognition
Chemical structures of various compounds used to probe the binding characteristics of the SAM-VI riboswitch. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2].
|
|
References
[1] SAM-VI RNAs selectively bind S-adenosylmethionine and exhibit similarities to SAM-III riboswitches.
Mirihana Arachchilage, G., Sherlock, M. E., Weinberg, Z., & Breaker, R. R.
RNA Biol. 15, 371–378 (2018).
[2] SAM-VI riboswitch structure and signature for ligand discrimination.
Sun, A., Gasser, C., Li, F., Chen, H., Mair, S., Krasheninina, O., Micura, R., & Ren, A.
Nat. Commun. 10, 5728 (2019).
[3] Observation of structural switch in nascent SAM-VI riboswitch during transcription at single-nucleotide and single-molecule resolution.
Xue, Y., Li, J., Chen, D., Zhao, X., Hong, L., & Liu, Y.
Nat. Commun. 14, 2320 (2023).
[4] Structure-based insights into recognition and regulation of SAM-sensing riboswitches.
Zheng L, Song Q, Xu X, Shen X, Li C, Li H, Chen H, Ren A.
Sci China Life Sci.66(1):31-50 (2023).