Rfam ID: RF00230 (T-box leader)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    1992[1] Discovery of T-box riboswitch

    tRNA as a regulator of transcription antitermination 1993[2]

    2005[3] Biochemical evidence for structural switch depend on the charge of bound tRNA

    Co-crystal structure of a T-box riboswitch stem I domain in complex with its cognate tRNA 2013[4]

    2013[5] Co-crystal structure of the Geobacillus kaustophilus glyQ T box riboswitch Stem I in complex with tRNA

    The first demonstration that the T-box RNA itself is able to sense and respond to tRNA aminoacylation in vitro 2014[6]

    2015[7] A T-box riboswitch subclass regulates at the level of translation initiation

    The kinetic and structural underpinnings of tRNA binding to a glycyl T-box riboswitch 2018[8]

    2018[9] smFRET demonstrate that the T-box riboswitch drive the two-step binding of the tRNA ligand

    The stem I and stem II domains of a Nocardia farcinica ileS translational T-box riboswitch in complex with its cognate tRNAIle2019[10]

    2019[11] Crystal structure of full-length T-box from Mycobacterium tuberculosis

    Co-crystal structure of Geobacillus kaustophilus T-box discriminator in complex with its cognate uncharged tRNAGly and Cryo-EM structures of Bacillus subtilis T-box-tRNA complexes 2019[12]

2023...



Description

Usually found in gram-positive bacteria, the T box leader sequence is an RNA element that controls gene expression through the regulation of translation by binding directly to a specific tRNA and sensing its aminoacylation state. This interaction controls expression of downstream aminoacyl-tRNA synthetase genes, amino acid biosynthesis, and uptake-related genes in a negative feedback loop. The uncharged tRNA acts as the effector for transcription antitermination of genes in the T-box leader family. The anticodon of a specific tRNA base pairs to a specifier sequence within the T-box motif, and the NCCA acceptor tail of the tRNA base pairs to a conserved bulge in the T-box antiterminator hairpin (From Wikipedia).


Gene association

The T-box mechanism is a common regulatory strategy used for modulating the expression of genes of amino acid metabolism-related operons in gram-positive bacteria, especially members of the Firmicutes. Amino acid biosynthesis that are regulated by the T-box mechanism. The T-box regulation of genes involved in the biosynthesis of Ala, Gly, Ser, Pro, Arg, Met, Cys, Ile, Leu, Val, Tyr, Phe, Trp, His, Asn, Asp, and Thr was confirmed[13].


Gene regulation

tRNA is outlined in purple surface and is shown as a ribbon. Solid and dotted lines represent common elements and variable elements, respectively, of T-boxes. Left, uncharged tRNA binds to a T-box through base pairing between the anticodon (green) and specifier sequence (yellow) and between the acceptor end (blue) and discriminatory sequence (red). These interactions drive formation of the antiterminator. Right, a tRNA charged with an amino acid (pink oval) is rejected by the T-box; this yields an alternative (terminator) conformation of the RNA. We present the prototypical mechanism, but not all possible mechanisms[14],[15].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the T-box riboswitch. Middle: Secondary structure depictions of the Mycobacterium tuberculosis ileS T-box riboswitch according to PDB ID: 6UFG. Bottom: Secondary structure depictions of the Bacillus subtilis glyQS T-box-tRNAGly complex according to PDB ID: 6POM. tRNA is colored in pale purple[11],[12].

5' GGCAUCGAUCCGGCGAUCACCGGGGAGCCUUCGGAAGAACGGCCGGUUAGGCCCAGUAGAACCGAACGGGUUGGCCCGUCACAGCCUCAAGUCGAGCGGCCGCGCGAAAGCGUGGCAAGCGGGGUGGCACCGCGGCGUUCGCGCGAAAGCGUGGCGUCGUCCCCGC 3' (Sequence from middle structure)

5' GUUGCAGUGAGAGAAAGAAGUACUUGCGUUACCUCAUGAAAGCGACCUUAGGGCGGUGUAAGCUAAGGAUGAGCACGCAACGAAAGGCAUUCUUGAGCAAUUUUAAAAAAGAGGCUGGGAUUUUGUUCUCAGCAACUAGGGUGGAACCGCGGGAGAACUCUCGUCCCUA 3' (Sequence from bottom structure)



3D visualisation

Co-crystal structure of the Mycobacterium tuberculosis ileS T-box in complex with tRNA-3'-OH was generated from PDB ID: 6UFG at 2.93 Å resolution. tRNA is colored in pale purple. Additional available structures that have been solved and detailed information are accessible on Structures page [11].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






4.9 Å resolution cryo-EM structure of a full-length the Bacillus subtilis glyQS T-box-tRNAGly complex was generated from PDB ID: 6POM. tRNA is colored in pale purple. Additional available structures that have been solved and detailed information are accessible on Structures page [12].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Interface

Details of the Mycobacterium tuberculosis ileS T-box riboswitch-tRNA interface. A, Overall structure of T-box riboswitch-tRNA (PDB ID: 6UFG at 2.93 Å resolution), tRNA is colored in pale purple. S1: the Mycobacterium tuberculosis aminoacylation sensing module bound to tRNAIle (pale purple) with the linker (yellow), Stem-III (pink) and AntiS (cyan) domains. S2: the Stem-II and its interaction with the codon-anticodon pair between Stem-I (green) and tRNAIle (pale purple). B, C, D, Enlarged aminoacylation sensing module (S1 in A). E, F, G, H, Enlarged decoding module (S2 in A) [11].

drawing


Details of the T-box riboswitch-tRNA (PDB ID: 6POM at 4.9 Å resolution) interface. A, Overall structure of T-box riboswitch-tRNA (PDB ID: 6POM at 4.9 Å resolution), tRNA is colored in pale purple. S1: the interface between the tRNA 3′ end and the discriminator. S2: interface between the tRNA anticodon and the T-box specifier. S3: interface between the tRNA elbow and stem I distal interdigitated T-loops. B, C, D, Enlarged aminoacylation sensing module (S1 in A). E, F, Enlarged decoding module (S2 in A). G, Enlarged decoding module (S3 in A)[12].

drawing


References

[1] Analysis of the Bacillus subtilis tyrS gene: conservation of a regulatory sequence in multiple tRNA synthetase genes.
Henkin, T. M., Glass, B. L. & Grundy, F. J.
J. Bacteriol. 174, (1992).

[2] tRNA as a positive regulator of transcription antitermination in B. subtilis.
Grundy, F. J. & Henkin, T. M.
Cell 74, 475–482 (1993).

[3] Structural transitions induced by the interaction between tRNA(Gly) and the Bacillus subtilis glyQS T box leader RNA.
Yousef, M. R., Grundy, F. J. & Henkin, T. M.
J. Mol. Biol. 349, 273–287 (2005).

[4] Co-crystal structure of a T-box riboswitch stem I domain in complex with its cognate tRNA.
Zhang, J. & Ferré-D’Amaré, A. R.
Nature 500, 363–366 (2013).

[5] Structural determinants for geometry and information decoding of tRNA by T box leader RNA.
Grigg, J. C. & Ke, A.
Structure 21, 2025–2032 (2013).

[6] Direct evaluation of tRNA aminoacylation status by the T-box riboswitch using tRNA-mRNA stacking and steric readout.
Zhang, J. & Ferré-D’Amaré, A. R.
Mol. Cell 55, (2014).

[7] T box riboswitches in Actinobacteria: translational regulation via novel tRNA interactions.
Sherwood, A. V., Grundy, F. J. & Henkin, T. M.
Proc. Natl. Acad. Sci. U. S. A. 112, 1113–1118 (2015).

[8] Hierarchical mechanism of amino acid sensing by the T-box riboswitch.
Suddala, K. C. et al.
Nat. Commun. 9, (2018).

[9] Specific structural elements of the T-box riboswitch drive the two-step binding of the tRNA ligand.
Zhang, J. et al.
Elife 7, (2018).

[10] High-affinity recognition of specific tRNAs by an mRNA anticodon-binding groove.
Suddala, K. C. & Zhang, J.
Nat. Struct. Mol. Biol. 26, (2019).

[11] Structural basis for tRNA decoding and aminoacylation sensing by T-box riboregulators.
Battaglia, R. A., Grigg, J. C. & Ke, A.
Nat. Struct. Mol. Biol. 26, 1106–1113 (2019).

[12] Structural basis of amino acid surveillance by higher-order tRNA-mRNA interactions.
Li, S. et al.
Nat. Struct. Mol. Biol. 26, 1094–1105 (2019).

[13] Biochemical features and functional implications of the RNA-based T-box regulatory mechanism.
Gutiérrez-Preciado, A., Henkin, T. M., Grundy, F. J., Yanofsky, C. & Merino, E.
Microbiol. Mol. Biol. Rev. 73, 36–61 (2009).

[14] T-box RNA gets boxed.
Weaver, J. W. & Serganov, A.
Nat. Struct. Mol. Biol. 26, 1081–1083 (2019).

[15] Unboxing the T-box riboswitches-A glimpse into multivalent and multimodal RNA-RNA interactions.
Zhang, J.
Wiley Interdiscip. Rev. RNA 11, e1600 (2020).