Rfam ID: RF01831 (THF riboswitch)
RF02977 (folE RNA)
Click the buttons to navigate to different sections:
Timeline
Description
Tetrahydrofolate riboswitches are a class of homologous RNAs in certain bacteria that bind tetrahydrofolate (THF). It is almost exclusively located in the probable 5' untranslated regions of protein-coding genes, and most of these genes are known to encode either folate transporters or enzymes involved in folate metabolism. For these reasons it was inferred that the RNAs function as riboswitches. THF riboswitches are found in a variety of Bacillota, specifically the orders Clostridiales and Lactobacillales, and more rarely in other lineages of bacteria. The THF riboswitch was one of many conserved RNA structures found in a project based on comparative genomics. The 3-d structure of the tetrahydrofolate riboswitch has been solved by separate groups using X-ray crystallography. These structures were deposited into the Protein Data Bank under accessions 3SD1 and 3SUX, with other entries containing variants. The folE RNA motif, now known as the THF-II riboswitch, is a conserved RNA structure that was discovered by bioinformatics. folE motifs are found in Alphaproteobacteria. folE motif RNAs likely function as cis-regulatory elements, in view of their positions upstream of protein-coding genes. Instances of the folE RNA motif are often located nearby to the predicted Shine-Dalgarno sequence of the downstream gene. This arrangement is consistent with a model of cis-regulation where the RNA allosterically controls access to the Shine-Dalgarno sequence, thus regulating the gene translationally. All known folE RNAs are present upstream of genes encoding GTP cyclohydrolase I, which performs a step in folate metabolism. folE RNAs have been shown to bind tetrahydrofolate and related molecules, leading to their designation as a second structural class of tetrahydrofolate riboswitches, called THF-II riboswitches (From Wikipedia).Gene association
Folate biosynthesis and uptake pathway of Escherichia coli. Genes under control of the THF-I (red bars) and THF-II (cyan bars) riboswitch are highlighted with relative frequency of regulatory interaction reflected by the heights of the bars[1,6].
|
|
Gene regulation
Potential mechanism of the THF-I riboswitch for controlling gene expression in Streptococcus mutans. The ribosome binding site (RBS) is showed on red. We present the prototypical mechanism, but not all possible mechanisms[7].
|
|
Potential mechanism of translation initiation regulation by the THF-II riboswitch in Mesorhizobium loti . The ribosome binding site (RBS) is showed on red. We present the prototypical mechanism, but not all possible mechanisms[8].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the THF-I riboswitch. Bottom: Secondary structure depictions of the Streptococcus mutans THF-I riboswitch according to PDB ID: 4LVV. The two molecules of folinic acid (FA) observed in the crystal structure are denoted in red.
5'GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCAUCCGCUCCA3' (Sequence from bottom structure )
Top: Consensus sequence and secondary structure model for the THF-II riboswitch. Bottom: Secondary structure depictions of the Mesorhizobium loti THF-II riboswitch according to PDB ID: 7WI9. Residues are numbered according to THF-II-loti62 WT RNA. The ribosome binding site (RBS) is boxed in red.
5'GGCGUGGUCCGUUCAACUCGUUCCUCGAAAGAGGAACUACGGGAGACGCC3' (Sequence from bottom structure )
The overall structure of the Streptococcus mutans THF-I riboswitch was generated from PDB ID: 4LVV at 2.10 Å resolution bound with 6S-folinic acid. 6S-folinic acid (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [4].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Streptococcus mutans THF-I riboswitch generated from PDB ID: 4LVV at 2.10 Å resolution. 6S-folinic acid (6S-FA) (shown in sticks) is labeled in red. Right: The hydrogen bonds of two binding sites of the THF-I riboswitch bound with 6S-FA[4].
Left: Surface representation of the binding pocket of the Mesorhizobium loti THF-II riboswitch generated from PDB ID: 7WI9 at 2.98 Å resolution. THF (shown in sticks) is labeled in red. Right: The hydrogen bonds of the binding site of the THF-II riboswitch bound with THF[8].
Ligand recognition
Chemical structures of tetrahydrofolate (THF) and its analogs. The apparent KD of each compound of THF-I and THF-II riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[1,4,6].
|
|
References
[1] A eubacterial riboswitch class that senses the coenzyme tetrahydrofolate.
Ames, T. D., Rodionov, D. A., Weinberg, Z. & Breaker, R. R.
Chem. Biol. 17, (2010).
[2] Long-range pseudoknot interactions dictate the regulatory response in the tetrahydrofolate riboswitch.
Huang, L., Ishibe-Murakami, S., Patel, D. J. & Serganov, A.
Proc. Natl. Acad. Sci. U. S. A. 108, (2011).
[3] The structure of a tetrahydrofolate-sensing riboswitch reveals two ligand binding sites in a single aptamer.
Trausch, J. J., Ceres, P., Reyes, F. E. & Batey, R. T.
Structure 19, (2011).
[4] A disconnect between high-affinity binding and efficient regulation by antifolates and purines in the tetrahydrofolate riboswitch.
Trausch, J. J. & Batey, R. T.
Chem. Biol. 21, (2014).
[5] Detection of 224 candidate structured RNAs by comparative analysis of specific subsets of intergenic regions.
Weinberg, Z. et al.
Nucleic Acids Res. 45, (2017).
[6] Biochemical validation of a second class of tetrahydrofolate riboswitches in bacteria.
Chen, X., Mirihana, A. G. & Breaker, R. R.
RNA 25, (2019).
[7] Tying the knot in the tetrahydrofolate (THF) riboswitch: A molecular basis for gene regulation.
Wilt, H. M., Yu, P., Tan, K., Wang, Y. X. & Stagno, J. R.
J. Struct. Biol. 213, (2021).
[8] Structural insights into translation regulation by the THF-II riboswitch.
Xu, L., Xiao, Y., Zhang, J. & Fang, X.
Nucleic Acids Res. 51, (2023).