Rfam ID: RF00059 (TPP riboswitch (THI element))
Click the buttons to navigate to different sections:
Timeline
Description
The TPP riboswitch, also known as the THI element and Thi-box riboswitch, is a highly conserved RNA secondary structure. It serves as a riboswitch that binds thiamine pyrophosphate (TPP) directly and modulates gene expression through a variety of mechanisms in archaea, bacteria and eukaryotes. TPP is the active form of thiamine (vitamin B1), an essential coenzyme synthesised by coupling of pyrimidine and thiazole moieties in bacteria. The THI element is an extension of a previously detected thiamin-regulatory element, the thi box, there is considerable variability in the predicted length and structures of the additional and facultative stem-loops represented in dark blue in the secondary structure diagram Analysis of operon structures has identified a large number of new candidate thiamin-regulated genes, mostly transporters, in various prokaryotic organisms. The x-ray crystal structure of the TPP riboswitch aptamer has been solved (From Wikipedia).Gene association
The biosynthetic pathway of TPP in Escherichia coli. The genes under contol of the TPP ribswtch are colored in red[1,7,20].
|
|
Gene regulation
Top: Typical mechanisms for the TPP riboswitch in Escherichia coli to repress gene expression. Translation initiation regulation (left, thiM genes). Transcription termination regulation (right, thiC genes). Complementary sequences and alternate base-pairing are shown in cyan. Shine–Dalgarno (SD) sequence and initiation codon are shaded green. TPP and Mg2+ ions are depicted in red and pink, respectively. Middle: Mechanism for the TPP riboswitch in Neurospora crassa to control of NMT1 expression in which key splicing determinants are activated (green lines) or inhibited (red lines) during different occupancy states of the aptamer. Bottom: Proposed mechanism for THIC TPP riboswitch function in plants includes control of splicing and alternative 3' end processing of transcripts. When TPP concentrations are low (left), portions of stems P4 and P5 interact with the 5' splice site and thereby prevent splicing. The transcript processing site located between the 5' splice site and the TPP aptamer is retained, and its use results in formation of transcripts with short 3' UTRs that permit high expression. In the presence of elevated TPP concentrations (right), TPP binds to the aptamer cotranscriptionally, which leads to a structural change that prevents interaction with the 5' splice site. Splicing occurs and removes the transcript processing site. Transcription continues and alternative processing sites in the extended 3' UTR give rise to THIC type III RNAs. The long 3' UTRs lead to increased RNA turnover, causing reduced expression of THIC. We present the prototypical mechanism, but not all possible mechanisms[3-6,9-10,12-14,26-27].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the TPP riboswitch. Bottom: Secondary structure depictions of the Escherichia coli TPP riboswitch according to PDB ID: 2GDI. The bound TPP is denoted in red[10].
5'GGACUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUUC3' (Sequence from bottom structure )
The overall structure of the Escherichia coli TPP riboswitch was generated from PDB ID: 2GDI at 2.05 Å resolution bound with TPP. TPP (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [10].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Escherichia coli TPP riboswitch generated from PDB ID: 2GDI at 2.05 Å resolution, coordinated Mg2+ ions (magenta) and water (green cyan spheres). TPP (shown in sticks) is colored in red. Right: Details of the interactions between the TPP and RNA, oordinated Mg2+ ions (magenta) and water (green cyan spheres)[10].
Ligand recognition
Chemical structures of thiamine pyrophosphate (TPP) and its analogs. TP is thiamine monophosphate, PTPP is Pyrithiamine pyrophosphate. The apparent KD of each compound is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[3,8-10,22-22].
|
|
References
[1] Thiamin biosynthesis in prokaryotes.
Begley, T. P. et al.
Arch. Microbiol. 171, (1999).
[2] A conserved RNA structure (thi box) is involved in regulation of thiamin biosynthetic gene expression in bacteria.
Miranda-Ríos, J., Navarro, M. & Soberón, M.
Proc. Natl. Acad. Sci. U. S. A. 98, (2001).
[3] Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression.
Winkler, W., Nahvi, A. & Breaker, R. R.
Nature 419, (2002).
[4] Comparative genomics of thiamin biosynthesis in procaryotes. New genes and regulatory mechanisms.
Rodionov, D. A., Vitreschak, A. G., Mironov, A. A. & Gelfand, M. S.
J. Biol. Chem. 277, 48949–48959 (2002).
[5] Metabolite-binding RNA domains are present in the genes of eukaryotes.
Sudarsan, N., Barrick, J. E. & Breaker, R. R.
RNA 9, (2003).
[6] Thiamine-regulated gene expression of Aspergillus oryzae thiA requires splicing of the intron containing a riboswitch-like domain in the 5'-UTR
Kubodera, T., M. Watanabe, K. Yoshiuchi, N. Yamashita, A. Nishimura, S. Nakai, K. Gomi and H. Hanamoto.
FEBS Lett 555(3): 516-520.(2003).
[7] Roles of Mg2+ in TPP-dependent riboswitch.
Yamauchi, T. et al.
FEBS Lett. 579, (2005).
[8] Thiamine pyrophosphate riboswitches are targets for the antimicrobial compound pyrithiamine.
Sudarsan, N., Cohen-Chalamish, S., Nakamura, S., Emilsson, G. M. & Breaker, R. R.
Chem. Biol. 12, (2005).
[9] Structure of the eukaryotic thiamine pyrophosphate riboswitch with its regulatory ligand.
Thore, S., Leibundgut, M. & Ban, N.
Science 312, (2006).
[10] Structural basis for gene regulation by a thiamine pyrophosphate-sensing riboswitch.
Serganov, A., Polonskaia, A., Phan, A. T., Breaker, R. R. & Patel, D. J.
Nature 441, (2006).
[11] Crystal Structures of the Thi-Box Riboswitch Bound to Thiamine Pyrophosphate Analogs Reveal Adaptive RNA-Small Molecule. Recognition
Edwards, T. E. & Ferré-D’Amaré, A. R.
Structure 14, (2006).
[12] Riboswitch-dependent gene regulation and its evolution in the plant kingdom.
Bocobza, S. et al.
Genes Dev. 21, (2007).
[13] Control of alternative RNA splicing and gene expression by eukaryotic riboswitches.
Cheah, M. T., Wachter, A., Sudarsan, N. & Breaker, R. R.
Nature 447, (2007).
[14] Riboswitch control of gene expression in plants by splicing and alternative 3' end processing of mRNAs.
Wachter, A. et al.
Plant Cell 19, (2007).
[15] Structural basis of thiamine pyrophosphate analogues binding to the eukaryotic riboswitch.
Thore, S., Frick, C. & Ban, N.
J. Am. Chem. Soc. 130, (2008).
[16] Thermodynamic analysis of ligand binding and ligand binding-induced tertiary structure formation by the thiamine pyrophosphate. riboswitch
Kulshina, N., Edwards, T. E. & Ferré-D’Amaré, A. R.
RNA 16, (2010).
[17] Riboswitch-mediated control of gene expression in eukaryotes.
Wachter, A.
RNA Biol. 7, (2010).
[18] Validating fragment-based drug discovery for biological RNAs: lead fragments bind and remodel the TPP riboswitch specifically.
Warner, K. D. et al.
Chem. Biol. 21, (2014).
[19] Thiamine pyrophosphate riboswitch in some representative plant species: a bioinformatics study.
Yadav, S., Swati, D. & Chandrasekharan, H.
J. Comput. Biol. 22, (2015).
[20] Phylogenomic and comparative analysis of the distribution and regulatory patterns of TPP riboswitches in fungi.
Mukherjee, S., Retwitzer, Barash, D. & Sengupta, S.
Sci. Rep. 8, (2018).
[21] A bacterial riboswitch class for the thiamin precursor HMP-PP employs a terminator-embedded aptamer.
Atilho, R. M., Mirihana, A. G., Greenlee, E. B., Knecht, K. M. & Breaker, R. R.
Elife 8, (2019).
[22] Identification and characterisation of thiamine pyrophosphate (TPP) riboswitch in Elaeis guineensis.
Subki, A., Ho, C. L., Ismail, N. F. N., Aa, Z. A. & Zn, B. Y.
PLoS One 15, (2020).
[23] Subsite Ligand Recognition and Cooperativity in the TPP Riboswitch: Implications for Fragment-Linking in RNA Ligand Discovery.
Zeller, M. J. et al.
ACS Chem. Biol. 17, (2022).
[24] SHAPE-enabled fragment-based ligand discovery for RNA.
Zeller, M. J. et al.
Proc. Natl. Acad. Sci. U. S. A. 119, (2022).
[25] Crystal structure of Escherichia coli thiamine pyrophosphate-sensing riboswitch in the apo state.
Lee, H. K. et al.
Structure (2023) doi:10.1016/j.str.2023.05.003.
[26] Transcriptional pausing at the translation start site operates as a critical checkpoint for riboswitch regulation.
Chauvier, A. et al.
Nat. Commun. 8, 13892 (2017).
[27] Eukaryotic TPP riboswitch regulation of alternative splicing involving long-distance base pairing.
Li, S. & Breaker, R. R.
Nucleic Acids Res. 41, 3022–3031 (2013).