Rfam ID: RF03054 (Xanthine riboswitch (NMT1 RNA))


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2017[1] Discovery of NMT1 motif

    Demonstration that NMT1 motif is xanthine-I riboswitch 2020[2]

    2021[3] Crystal structure of xanthine-I riboswitch

    Discovery of xanthine-II riboswitch 2022[4]

2023...



Description

There are currently two classes of xanthine riboswitches. The xanthine-I riboswitch, formerly known as the NMT1 motif RNA, is associated with genes annotated encoding various dioxygenases, transporters, or proteins, and tightly binds 8-azaxanthine, xanthine, and uric acid. It functions to shut down gene expression following ligand binding, possibly by regulating translation initiation. Xanthine-II riboswitch is a class of xanthine-sensing guanine riboswitch variants that are frequently associated with genes annotated to encode dioxygenase, allantoinase, and xanthine dehydrogenase. The structure of these RNAs is consistent with a genetic "ON" switch, in which ligand binding activates gene expression[2,4].


Gene association

Basic purine degradation and utilization pathways of Klebsiella pneumoniae. Xanthine riboswitches participate in regulating the degradation or salvation of various purine compounds[2].

drawing


Gene regulation

Sequence and secondary structure model of the xanthine-II riboswitch in Paenibacillus is consistent with a genetic “ON” switch wherein ligand binding would preclude formation of the terminator stem. We present the prototypical mechanism, but not all possible mechanisms[4].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the xanthine-I riboswitch. Bottom: Secondary structure depictions of the proteobacteria xanthine-I riboswitch according to PDB ID: 7ELR [2].

5'GAGUAGAAGCGUUCAGCGGCCGAAAGGCCGCCCGGAAAUUGCUCC3' (Sequence from bottom structure )



Consensus sequence and secondary structure model for the xanthine-II riboswitch[4].


Document
drawing



3D visualisation

The overall structure of the proteobacteria xanthine-I riboswitch was generated from PDB ID: 7ELR at 2.66 Å resolution bound with xanthine. Xanthine (shown in sticks) is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the proteobacteria xanthine-I riboswitch generated from PDB ID: 7ELR at 2.66 Å resolution. Xanthine (shown in sticks) is labeled in red. Right: Ligand interaction between xanthine and xanthine-I riboswitch[3].

drawing drawing


Ligand recognition

Chemical structures of xanthine and its analogs. The apparent KD of each compound of xanthine-I and xanthine-II riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2,4].

drawing



References

[1] Detection of 224 candidate structured RNAs by comparative analysis of specific subsets of intergenic regions.
Weinberg, Z. et al.
Nucleic Acids Res. 45, 10811–10823 (2017).

[2] A bacterial riboswitch class senses xanthine and uric acid to regulate genes associated with purine oxidation.
Yu, D. & Breaker, R. R.
RNA 26, 960–968 (2020).

[3] Insights into xanthine riboswitch structure and metal ion-mediated ligand recognition.
Xu, X. et al.
Nucleic Acids Res. 49, 7139–7153 (2021).

[4] Variants of the guanine riboswitch class exhibit altered ligand specificities for xanthine, guanine, or 2'-deoxyguanosine.
Hamal Dhakal, S., Panchapakesan, S. S. S., Slattery, P., Roth, A. & Breaker, R. R.
Proc. Natl. Acad. Sci. U. S. A. 119, e2120246119 (2022).