Rfam ID: RF01750 (ZMP/ZTP riboswitch)
Click the buttons to navigate to different sections:
Timeline
Description
The ZMP/ZTP riboswitch (called the pfl RNA motif before) refers to a conserved RNA structure present in some bacteria and originally discovered using bioinformatics. ZMP/ZTP riboswitch are consistently present in genomic locations that likely correspond to the 5' untranslated regions (5' UTRs) of protein-coding genes. This arrangement in bacteria is commonly associated with cis-regulatory elements. Moreover, they are in presumed 5' UTRs of multiple non-homologous genes, suggesting that they function only in these locations. Additional evidence of cis-regulatory function came from the observation that predicted rho-independent transcription terminators overlap pfl RNAs. This overlap suggests that the alternate secondary structures of pfl RNA and the transcription terminator stem-loops compete with each other, and this is a common mechanism for cis gene control in bacteria. ZMP/ZTP riboswitch are found in a variety of phyla of bacteria, but are not found in all the species of that phylum. ZMP/ZTP riboswitch are common among species of orders Actinomycetales and Clostridiales, the classes Alphaproteobacteria and Betaproteobacteria and the genus Deinococcus. They are also found in isolated species of Bacteroidota, Chloroflexota, and Deltaproteobacteria. The genes regulated by ZMP/ZTP riboswitch relate to one-carbon metabolism. Most obviously, for example, formate-tetrahydrofolate ligase synthesizes 10-formyltetrahydrofolate. The glyA and folD convert between other one-carbon adducts of tetrahydrofolate. Another gene commonly associated with ZMP/ZTP riboswitch is purH, which catalyzes the formylation of the intermediate AICAR in de novo synthesis of purines. The formyl group is taken from formyltetrahydrofolate, and purine biosynthesis is often the dominant user of formyltetrahydrofolate. In similar fashions, if less directly, most ZMP/ZTP riboswitch are associated with genes that are directly or indirectly involved in one-carbon metabolism. It appears that the ZTP/ZMP purine derivatives can be used to regulate one-carbon metabolism by indirectly sensing a shortage of 10-formyl-tetrahydrofolate. The atomic-resolution structure has been solved by X-ray crystallography. These structures were deposited into the Protein Data Bank under accessions 4ZNP (From Wikipedia).Gene association
Purine biosynthesis pathway of the ZMP/ZTP riboswitch derived from the γ-proteobacterium Pectobacterium carotovorum. Genes most frequently associated with ZMP/ZTP riboswitch are highlighted in red and genes that are occasionally associated are highlighted in green. Genes in black have not been observed to be associated with ZMP/ZTP riboswitch[2].
|
|
Gene regulation
Potential mechanism of translation regulation by the ZMP/ZTP riboswitch derived from the rhtB gene of the bacterial species Pectobacterium carotovorum. The ribosome binding site (RBS) is showed on red. We present the prototypical mechanism, but not all possible mechanisms[11].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the ZMP/ZTP riboswitch. Bottom: Secondary structure depictions of the ZMP/ZTP riboswitch from the pfl motif of Thermosinus carboxydivorans according to PDB ID: 4ZNP[3].
5'GGGAUACAGGACUGGCGGAUUAGUGGGAAACCACGUGGACUGUAUCCGAAAAAAAGCCGACCGCCUGGGCAUC3' (Sequence from bottom structure )
The overall structure of the Thermosinus carboxydivorans ZMP/ZTP riboswitch was generated from PDB ID: 4ZNP at 2.94 Å resolution bound with 5- amino-4-imidazole carboxamide ribose-5'- monophosphate (ZMP) and Mg2+. ZMP (shown in sticks) and Mg2+ is labeled in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Thermosinus carboxydivorans ZMP/ZTP riboswitch generated from PDB ID: 4ZNP at 2.94 Å resolution. 5- amino-4-imidazole carboxamide ribose-5'- monophosphate (ZMP) (shown in sticks) and Mg2+ (M) is labeled in red. Right: The hydrogen bonds of the ZTP riboswitch bound with 5- amino-4-imidazole carboxamide ribose-5'- monophosphate (ZMP) and Mg2+ (M)[3].
Ligand recognition
Chemical structures of 5- amino-4-imidazole carboxamide ribose-5'-triphosphate (ZTP) and its analogs. The apparent KD of each compound of ZMP/ZTP riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2,8].
|
|
References
[1] Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes
Weinberg, Z. et al.
Genome Biol. 11, R31 (2010).
[2] An ancient riboswitch class in bacteria regulates purine biosynthesis and one-carbon metabolism
Kim, P. B., Nelson, J. W. & Breaker, R. R.
Mol. Cell 57, 317–328 (2015).
[3] Global RNA Fold and Molecular Recognition for a pfl Riboswitch Bound to ZMP, a Master Regulator of One-Carbon Metabolism
Ren, A., Rajashankar, K. R. & Patel, D. J.
Structure 23, 1375–1381 (2015).
[4] Metal Ion-Mediated Nucleobase Recognition by the ZTP Riboswitch
Trausch, J. J., Marcano-Velázquez, J. G., Matyjasik, M. M. & Batey, R. T.
Chem. Biol. 22, 829–837 (2015).
[5] Recognition of the bacterial alarmone ZMP through long-distance association of two RNA subdomains
Jones, C. P. & Ferré-D’Amaré, A. R.
Nat. Struct. Mol. Biol. 22, 679–685 (2015).
[6] Co-crystal structure of the Fusobacterium ulcerans ZTP riboswitch using an X-ray free-electron laser
Jones, C. et al.
Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 75, 496–500 (2019).
[7] A ligand-gated strand displacement mechanism for ZTP riboswitch transcription control
Strobel, E. J., Cheng, L., Berman, K. E., Carlson, P. D. & Lucks, J. B.
Nat. Chem. Biol. 15, 1067–1076 (2019).
[8] Parallel Discovery Strategies Provide a Basis for Riboswitch Ligand Design
Tran, B. et al.
Cell Chem Biol 27, 1241–1249.e4 (2020).
[9] Real-time monitoring of single ZTP riboswitches reveals a complex and kinetically controlled decision landscape
Hua, B. et al.
Nat. Commun. 11, 4531 (2020).
[10] Tuning strand displacement kinetics enables programmable ZTP riboswitch dynamic range in vivo
Bushhouse, D. Z. & Lucks, J. B.
Nucleic Acids Res. 51, 2891–2903 (2023).
[11] Employing a ZTP Riboswitch to Detect Bacterial Folate Biosynthesis Inhibitors in a Small Molecule High-Throughput Screen
Perkins, K. R., Atilho, R. M., Moon, M. H. & Breaker, R. R.
ACS Chem. Biol. 14, 2841–2850 (2019).