Rfam ID: RF00379 (YdaO/YuaA leader)
Click the buttons to navigate to different sections:
Timeline
Description
The YdaO/YuaA leader (now called the cyclic di-AMP riboswitch) is a conserved RNA structure found upstream of the ydaO and yuaA genes in Bacillus subtilis and related genes in other bacteria. Its secondary structure and gene associations were predicted by bioinformatics. These RNAs function as riboswitches, and sense the signaling molecule cyclic di-AMP.Gene regulation
Potential mechanism of the c-di-AMP riboswitch for controlling gene expression in Caldanaerobacter subterraneus subsp. The ribosome binding site (c-di-AMP) is showed on red. We present the prototypical mechanism, but not all possible mechanisms[8].
|
|
Structure and Ligand recognition
2D representation
Top: Consensus sequence and secondary structure model for the c-di-AMP riboswitch. Bottom: Secondary structure depictions of the Caldanaerobacter subterraneus subsp c-di-AMP riboswitch according to PDB ID: 4QLM. The molecule of the Cyclic diadenylate (c-di-AMP) observed in the crystal structure are denoted in red[5].
5'GGAUCGCUGAACCCGAAAGGGGCGGGGGACCCAGAAAUGGGGCGAAUCUCUUCCGAAAGGAAGAGUAGGGUUACUCCUUCGACCCGAGCCCGUCAGCUAACCUCGCAAGCGUCCGAAGGAGAAUC3' (Sequence from bottom structure )
The overall structure of the Caldanaerobacter subterraneus subsp c-di-AMP riboswitch was generated from PDB ID: 4QLM at 2.72 Å resolution bound with 6S-c-di-AMP. 6S-c-di-AMP (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [5].3D visualisation
(Clicking the "Settings/Controls info" to turn Spin off)
|
|
|
Binding pocket
Left: Surface representation of the binding pocket of the Caldanaerobacter subterraneus subsp c-di-AMP riboswitch generated from PDB ID: 4QLM at 2.72 Å resolution. 6S-c-di-AMP (6S-c-di-AMP) (shown in sticks) is labeled in red. Right: The hydrogen bond of binding sites of the c-di-AMP riboswitch bound with 6S-c-di-AMP.Both Aα and Aβ of c-di-AMP molecule A are wedged between bases of the RNA and their base and cyclic dinucleotide backbone form similar patterns of intermolecular hydrogen bonds with the sugar-phosphate backbone[5].
Ligand recognition
Chemical structures of Cyclic diadenylate(c-di-AMP) and its analogs. The apparent KD of each compound of c-di-AMP riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[4].
|
|
References
[1] New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control.
Barrick, J. E. et al.
Proc. Natl. Acad. Sci. U. S. A. 101, 6421–6426 (2004).
[2] Structural and biochemical determinants of ligand binding by the c-di-GMP riboswitch
Kathryn, D. S. et al.
Biochemistry34,(2010)
[3] The ydaO motif is an ATP-sensing riboswitch in Bacillus subtilis.
Watson, P. Y. & Fedor, M. J.
Nat. Chem. Biol. 8, 963–965 (2012).
[4] Riboswitches in eubacteria sense the second messenger c-di-AMP.
Nelson, J. W. et al.
Nat. Chem. Biol. 9, 834–839 (2013).
[5] c-di-AMP binds the ydaO riboswitch in two pseudo-symmetry-related pockets.
Ren, A. & Patel, D. J.
Nat. Chem. Biol. 10, 780–786 (2014).
[6] Structural insights into recognition of c-di-AMP by the ydaO riboswitch.
Gao, A. & Serganov, A.
Nat. Chem. Biol. 10, 787–792 (2014).
[7] Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.
Jones, C. P. & Ferré-D’Amaré, A. R.
EMBO J. 33, 2692–2703 (2014).
[8] A c-di-AMP riboswitch controlling kdpFABC operon transcription regulates the potassium transporter system in Bacillus thuringiensis.
Wang, X. et al.
Commun Biol 2, 151 (2019).
[9] Structures of microRNA-precursor apical junctions and loops reveal noncanonical base pairs important for processing
Shoffner, G.M., Peng, Z., Guo, F.
bioRxiv; 2020.
[10] C-di-AMP Is a Second Messenger in Corynebacterium glutamicum That Regulates Expression of a Cell Wall-Related Peptidase via a Riboswitch.
Reich, S. J. et al.
Microorganisms 11, (2023).