Rfam ID: RF00379 (YdaO/YuaA leader)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2004[1] The ydaO motif was first identified

    The ydaO motif specifically bound ATP 2012[3]

    2013[4] c-di-AMP is the real ligand of ydaO motif

    Crystal structure of the Thermoanaerobacter tengcongensis c-di-AMP riboswitch binding with c-di-AMP 2014[5]

    2014[6] Crystal structures of the c-di-AMP riboswitch from Thermoanaerobacter pseudethanolicus and Thermovirga lienii

    Crystal structure of the Bacillus subtilis c-di-AMP riboswitch 2014[7]

    2019[8] The combination of c-di-AMP and riboswitch promotes the internal termination of blocking kdpFABC transcription

    Structure of Human pir-miRNA-202 Apical Loop and One-base-pair Fused to the c-di-AMP riboswitch Scaffold 2020[9]

    2023[10] c-di-AMP riboswitch may affect the translation of downstream genes

2023...



Description

The YdaO/YuaA leader (now called the cyclic di-AMP riboswitch) is a conserved RNA structure found upstream of the ydaO and yuaA genes in Bacillus subtilis and related genes in other bacteria. Its secondary structure and gene associations were predicted by bioinformatics. These RNAs function as riboswitches, and sense the signaling molecule cyclic di-AMP.


Gene regulation

Potential mechanism of the c-di-AMP riboswitch for controlling gene expression in Caldanaerobacter subterraneus subsp. The ribosome binding site (c-di-AMP) is showed on red. We present the prototypical mechanism, but not all possible mechanisms[8].

drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the c-di-AMP riboswitch. Bottom: Secondary structure depictions of the Caldanaerobacter subterraneus subsp c-di-AMP riboswitch according to PDB ID: 4QLM. The molecule of the Cyclic diadenylate (c-di-AMP) observed in the crystal structure are denoted in red[5].

5'GGAUCGCUGAACCCGAAAGGGGCGGGGGACCCAGAAAUGGGGCGAAUCUCUUCCGAAAGGAAGAGUAGGGUUACUCCUUCGACCCGAGCCCGUCAGCUAACCUCGCAAGCGUCCGAAGGAGAAUC3' (Sequence from bottom structure )



3D visualisation

The overall structure of the Caldanaerobacter subterraneus subsp c-di-AMP riboswitch was generated from PDB ID: 4QLM at 2.72 Å resolution bound with 6S-c-di-AMP. 6S-c-di-AMP (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [5].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Caldanaerobacter subterraneus subsp c-di-AMP riboswitch generated from PDB ID: 4QLM at 2.72 Å resolution. 6S-c-di-AMP (6S-c-di-AMP) (shown in sticks) is labeled in red. Right: The hydrogen bond of binding sites of the c-di-AMP riboswitch bound with 6S-c-di-AMP.Both Aα and Aβ of c-di-AMP molecule A are wedged between bases of the RNA and their base and cyclic dinucleotide backbone form similar patterns of intermolecular hydrogen bonds with the sugar-phosphate backbone[5].

drawing drawing


Ligand recognition

Chemical structures of Cyclic diadenylate(c-di-AMP) and its analogs. The apparent KD of each compound of c-di-AMP riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[4].

drawing



References

[1] New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control.
Barrick, J. E. et al.
Proc. Natl. Acad. Sci. U. S. A. 101, 6421–6426 (2004).

[2] Structural and biochemical determinants of ligand binding by the c-di-GMP riboswitch
Kathryn, D. S. et al.
Biochemistry34,(2010)

[3] The ydaO motif is an ATP-sensing riboswitch in Bacillus subtilis.
Watson, P. Y. & Fedor, M. J.
Nat. Chem. Biol. 8, 963–965 (2012).

[4] Riboswitches in eubacteria sense the second messenger c-di-AMP.
Nelson, J. W. et al.
Nat. Chem. Biol. 9, 834–839 (2013).

[5] c-di-AMP binds the ydaO riboswitch in two pseudo-symmetry-related pockets.
Ren, A. & Patel, D. J.
Nat. Chem. Biol. 10, 780–786 (2014).

[6] Structural insights into recognition of c-di-AMP by the ydaO riboswitch.
Gao, A. & Serganov, A.
Nat. Chem. Biol. 10, 787–792 (2014).

[7] Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.
Jones, C. P. & Ferré-D’Amaré, A. R.
EMBO J. 33, 2692–2703 (2014).

[8] A c-di-AMP riboswitch controlling kdpFABC operon transcription regulates the potassium transporter system in Bacillus thuringiensis.
Wang, X. et al.
Commun Biol 2, 151 (2019).

[9] Structures of microRNA-precursor apical junctions and loops reveal noncanonical base pairs important for processing
Shoffner, G.M., Peng, Z., Guo, F.
bioRxiv; 2020.

[10] C-di-AMP Is a Second Messenger in Corynebacterium glutamicum That Regulates Expression of a Cell Wall-Related Peptidase via a Riboswitch.
Reich, S. J. et al.
Microorganisms 11, (2023).