Rfam ID: RF01051 (Cyclic di-GMP-I riboswitch)

    RF03167 (c-di-GMP-I-GGC riboswitch)

    RF03168 (c-di-GMP-I-UAU riboswitch)

    RF01786 (Cyclic di-GMP-II riboswitch)

    RF03169 (c-di-GMP-II-GAG riboswitch)

    RF03170 (c-di-GMP-II-GCG riboswitch)


Horizontally arranged click buttons

Click the buttons to navigate to different sections:


Timeline

Start

    2007[1] Discovery of GEMM motif

    Discovery of c-di-GMP riboswitch 2008[2]

    2009[3] Structure of a c-di-GMP riboswitch from V. cholerae

    Native and mutant structure of c-di-GMP riboswitch 2010[4]

    2010[5] Discovery of c-di-GMP-II riboswitch

    Structure of a c-di-GMP-II riboswitch from C. acetobutylicum bound to c-di-GMP 2011[6]

    2012[7] Structural and biochemical characterization of linear dinucleotide analogues bound to the c-di-GMP-I aptamer

    T4P gene transcription is upregulated by c-di-GMP  2015[8]

    2018[9] Identified the secondary structures that are possibly responsible for switch-OFF and switch-ON states of translational initiation

2023...



Description

Cyclic di-GMP-I riboswitches are a class of riboswitch that specifically bind cyclic di-GMP, which is a second messenger that is used in a variety of microbial processes including virulence, motility and biofilm formation. Cyclic di-GMP-I riboswitches were originally identified by bioinformatics as a conserved RNA-like structure called the "GEMM motif". These riboswitches are present in a wide variety of bacteria, and are most common in Clostridia and certain varieties of Pseudomonadota. The riboswitches are present in pathogens such as Clostridium difficile, Vibrio cholerae (which causes cholera) and Bacillus anthracis (which causes anthrax). Geobacter uraniumreducens is predicted to have 30 instances of this riboswitch in its genome. A bacteriophage that infects C. difficile is predicted to carry a cyclic di-GMP-I riboswitch, which it might use to detect and exploit the physiological state of bacteria that it infects Cyclic di-GMP-II riboswitches (also c-di-GMP-II riboswitches) form a class of riboswitches that specifically bind cyclic di-GMP, a second messenger used in multiple bacterial processes such as virulence, motility and biofilm formation. Cyclic di-GMP II riboswitches are structurally unrelated to cyclic di-GMP-I riboswitches, though they have the same function.Cyclic di-GMP-II riboswitches were discovered by bioinformatics, and are common in species within the class Clostridia and the genus Deinococcus. They are also found in some other bacterial lineages. There is significant overlap between species that use cyclic di-GMP-I and cyclic di-GMP-II riboswitches, as both riboswitch classes are common in Clostridia (From Wikipedia).


Gene regulation

Potential mechanism of the c-di-GMP riboswitch for controlling gene expression in Vibrio cholerae. The ribosome binding site (c-di-GMP) is showed on red. We present the prototypical mechanism, but not all possible mechanisms[8].

drawing drawing



Structure and Ligand recognition

2D representation

Top: Consensus sequence and secondary structure model for the c-di-GMP-I riboswitch. Bottom: Secondary structure depictions of the Homo sapiens, Vibrio cholerae c-di-GMP-I riboswitch according to PDB ID: 3IRW. The molecule of the cyclic diguanylate (c-di-GMP-I) observed in the crystal structure are denoted in red[2].

5'GGUCACGCACAGGGCAAACCAUUCGAAAGAGUGGGACGCAAAGCCUCCGGCCUAAACCAUUGCACUCCGGUAGGUAGCGGGGUUACCGAUGG3' (Sequence from bottom structure )



Top: Consensus sequence and secondary structure model for the c-di-GMP-II riboswitch. Bottom: Secondary structure depictions of the Clostridium acetobutylicum c-di-GMP-II riboswitch according to PDB ID: 3Q3Z. The molecule of the cyclic diguanylate (c-di-GMP-II) observed in the crystal structure are denoted in red[5].

5'GCGCGGAAACAAUGAUGAAUGGGUUUAAAUUGGGCACUUGACUCAUUUUGAGUUAGUAGUGCAACCGACCGUGCU3' (Sequence from bottom structure )



3D visualisation

The overall structure of the Homo sapiens Vibrio cholerae c-di-GMP-I riboswitch was generated from PDB ID: 3IRW at 2.70 Å resolution bound with 6S-c-di-GMP-I. 6S-c-di-GMP-I (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [3].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






The overall structure of the Clostridium acetobutylicum c-di-GMP-II riboswitch was generated from PDB ID: 3Q3Z at 2.51 Å resolution bound with 6S-c-di-GMP-II. 6S-c-di-GMP-II (shown in sticks) is colored in red. Additional available structures that have been solved and detailed information are accessible on Structures page [6].

(Clicking the "Settings/Controls info" to turn Spin off)      

drawing PDBe Molstar






Binding pocket

Left: Surface representation of the binding pocket of the Homo sapiens Vibrio cholerae c-di-GMP-I riboswitch generated from PDB ID: 3IRW at 2.70 Å resolution. 6S-c-di-GMP-I (6S-c-di-GMP-I) (shown in sticks) is labeled in red. Right: The hydrogen bond of binding sites of the c-di-GMP-I riboswitch bound with 6S-c-di-GMP-I[3].

drawing drawing


Left: Surface representation of the binding pocket of the Homo sapiens Vibrio cholerae c-di-GMP-II riboswitch generated from PDB ID: 3Q3Z at 2.51 Å resolution. 6S-c-di-GMP-II (6S-c-di-GMP-II) (shown in sticks) is labeled in red. Right: The hydrogen bond of binding sites of the c-di-GMP-II riboswitch bound with 6S-c-di-GMP-II[6].

drawing drawing


Ligand recognition

Chemical structures of cyclic diguanylate(c-di-GMP) and its analogs. The apparent KD of each compound of c-di-GMP riboswitch is shown on bottom. Refer to the corresponding references for comprehensive details regarding reaction conditions and species information in measuring the dissociation constant displayed below[2,5].

drawing



References

[1] Identification of 22 candidate structured RNAs in bacteria using the CMfinder comparative genomics pipeline
Weinberg, Z. et al.
Nucleic Acids Res. 35, 4809–4819 (2007)

[2] Riboswitches in eubacteria sense the second messenger cyclic di-GMP
Sudarsan, N. et al.
Science 321, 411–413 (2008)

[3] Structural basis of ligand binding by a c-di-GMP riboswitch
Smith, K. D. et al
Nat. Struct. Mol. Biol. 16, 1218–1223 (2009)

[4] Structural and biochemical determinants of ligand binding by the c-di-GMP riboswitch
Smith, K. D., Lipchock, S. V., Livingston, A. L., Shanahan, C. A. & Strobel, S. A.
Biochemistry 49, 7351–7359 (2010)

[5] An allosteric self-splicing ribozyme triggered by a bacterial second messenger
Lee, E. R., Baker, J. L., Weinberg, Z., Sudarsan, N. & Breaker, R. R.
Science 329, 845–848 (2010)

[6] Structural basis of differential ligand recognition by two classes of bis-(3'-5')-cyclic dimeric guanosine monophosphate-binding riboswitches
Smith, K. D., Shanahan, C. A., Moore, E. L., Simon, A. C. & Strobel, S. A.
Proc. Natl. Acad. Sci. U. S. A. 108, 7757–7762 (2011)

[7] Structural and biochemical characterization of linear dinucleotide analogues bound to the c-di-GMP-I aptamer
Smith, K. D., Lipchock, S. V. & Strobel, S. A.
Biochemistry 51, 425–432 (2012)

[8] Nucleotide, c-di-GMP, c-di-AMP, cGMP, cAMP, (p)ppGpp signaling in bacteria and implications in pathogenesis
Kalia, D. et al.
Chem. Soc. Rev. 42, 305–341 (2013)

[9] Cyclic di-GMP riboswitch-regulated type IV pili contribute to aggregation of Clostridium difficile
Bordeleau, E. et al.
J. Bacteriol. 197, 819–832 (2015)

[10] Recognition of cyclic-di-GMP by a riboswitch conducts translational repression through masking the ribosome-binding site distant from the aptamer domain
Inuzuka, S. et al.
Genes Cells 23, 435–447 (2018)